ID: 975375900

View in Genome Browser
Species Human (GRCh38)
Location 4:73645716-73645738
Sequence CTTGGCCTGTGGCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975375900_975375914 30 Left 975375900 4:73645716-73645738 CCCTCCACTTGCCACAGGCCAAG No data
Right 975375914 4:73645769-73645791 GACCCACATGGAGTACTGCCAGG No data
975375900_975375910 18 Left 975375900 4:73645716-73645738 CCCTCCACTTGCCACAGGCCAAG No data
Right 975375910 4:73645757-73645779 ACCACCACCACAGACCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975375900 Original CRISPR CTTGGCCTGTGGCAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr