ID: 975384526

View in Genome Browser
Species Human (GRCh38)
Location 4:73740319-73740341
Sequence AATACTGAAGCTCCACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975384526 Original CRISPR AATACTGAAGCTCCACAATT TGG (reversed) Intergenic
902228144 1:15009651-15009673 AAGACTCAAGCTCCACCATTTGG + Intronic
906148690 1:43575290-43575312 ACTACTGAACTTCCCCAATTTGG - Intronic
908627432 1:66060184-66060206 AATCCTGAAGCTTCACAACTCGG - Intronic
908782719 1:67706342-67706364 AATCCTGAAGCTCCACAACTTGG - Intronic
910235603 1:85032767-85032789 TAAACTGAAGCTCCACTGTTAGG + Exonic
911503193 1:98714646-98714668 AACACTGGTGCTCCAGAATTTGG - Intronic
917220136 1:172719925-172719947 ACTGCTGATGCTCCACAGTTGGG - Intergenic
920833439 1:209485798-209485820 AATACTAAAGCGACATAATTTGG - Intergenic
921557817 1:216620324-216620346 AATACTGATGGTTTACAATTAGG - Intronic
922580636 1:226695352-226695374 AAGACTGAAGGTCCATATTTTGG + Intronic
924618426 1:245635899-245635921 TATTCTGAAACTCCACAACTTGG - Intronic
1064862967 10:19847476-19847498 AATGCTGAATCTCCACACTTGGG - Intronic
1065062745 10:21923979-21924001 AATACAGAAGATTCATAATTAGG - Intronic
1066648202 10:37631976-37631998 AATACAGAAGCTACACTACTGGG + Intergenic
1075425447 10:122338521-122338543 AAAACTGAAGCTCTGCAGTTTGG + Intergenic
1077944047 11:6875745-6875767 AATAACGAAGCTTCAAAATTGGG - Intergenic
1079792230 11:24753113-24753135 AATACTGAAGCTACATTGTTAGG - Intronic
1082709077 11:56530833-56530855 AAGACATAATCTCCACAATTTGG + Intergenic
1083168874 11:60910233-60910255 AATACTAAAGCACCATACTTTGG + Intergenic
1086164553 11:83762558-83762580 AATACTTAATCTCAACACTTAGG - Intronic
1088641121 11:111873818-111873840 AATAGTTAGGCTCCACATTTGGG - Intergenic
1092257078 12:6932771-6932793 AAAAATGAAGTTCTACAATTTGG + Intronic
1094272727 12:28635425-28635447 AATACTGAGACTGAACAATTGGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1098969564 12:76836819-76836841 AATAATGAAACTCCAAAATATGG - Intronic
1102841564 12:116130296-116130318 AAAATTGAAGCTGCACAATCTGG - Intronic
1102996323 12:117353804-117353826 AAAACTAAATCTCCACATTTTGG + Intronic
1104062950 12:125283299-125283321 ACTACTGAAGCTCAAAAACTTGG - Intronic
1113066668 13:106379606-106379628 AATACCAAAGTTCCACATTTTGG + Intergenic
1115908191 14:38224671-38224693 GATTCTGAAGCTCCACAAATTGG - Intergenic
1116897472 14:50331249-50331271 AATAGGGAAACTCCACTATTTGG - Exonic
1118545577 14:66884221-66884243 GGTATTGCAGCTCCACAATTAGG + Intronic
1125187904 15:36953220-36953242 AATACTCTAGTTCCACAGTTTGG - Intronic
1125408114 15:39374850-39374872 AATACTGAAACTGCAAAATTTGG - Intergenic
1132524345 16:406933-406955 TACACTGAAGCTCCATATTTAGG - Intronic
1137319572 16:47367009-47367031 AATACTGGAGGTCCAAACTTTGG - Intronic
1140229279 16:73104168-73104190 AATACTTAATCTCCACGTTTTGG + Intergenic
1140631551 16:76858991-76859013 AATATGGGAGCTCCAGAATTAGG - Intergenic
1142837916 17:2602891-2602913 GGTACTGAGGCTCCACAGTTGGG + Intronic
1149489496 17:57072811-57072833 AATATAAAAGCTCCACAAATAGG + Intergenic
1153531387 18:6050093-6050115 AATACTCATGCTACTCAATTGGG + Intronic
1156548804 18:37993224-37993246 GACACTGAAGCACCACACTTTGG - Intergenic
1158159018 18:54458609-54458631 AATCCTGGATCTCCACAACTAGG - Intergenic
1159524943 18:69576205-69576227 AATATTGGATCTCCAGAATTGGG + Intronic
928674844 2:33640340-33640362 AAAACTGAAGCCCCAAAATGTGG + Intergenic
933577351 2:84084460-84084482 AATTCTGGGGATCCACAATTTGG - Intergenic
933691676 2:85183842-85183864 AAGCCTGAAGCTCCAGAAGTGGG - Intronic
935044180 2:99464970-99464992 AATACAGAAGCTCCACCATGAGG - Exonic
935153805 2:100464280-100464302 AATTCTGAAGGTCAGCAATTTGG - Intergenic
939067354 2:137499683-137499705 AATACTGAAGCTCCTTCAATTGG + Intronic
939428184 2:142068141-142068163 AAAACAGAATCTCCAAAATTTGG + Intronic
939934324 2:148271547-148271569 AAAAGTAAAGCTCCACAATGAGG - Intronic
941126792 2:161594178-161594200 ACTAATAAAGCTCCATAATTGGG - Intronic
942235261 2:173897857-173897879 AATACTGAAGGTCCAGGTTTAGG + Intergenic
946607256 2:221419199-221419221 AATACTGAATCTTCACACTCCGG + Exonic
1171091427 20:22288996-22289018 GATAATGAAGCACCACCATTTGG + Intergenic
1172960125 20:38793166-38793188 AATACAGCAGCTCCACATTTAGG - Intergenic
1174325576 20:49776143-49776165 AAGACAGAAGATCCCCAATTCGG + Intergenic
1179004531 21:37499995-37500017 CATACTCAAGCTCCACAAGGAGG - Intronic
949902679 3:8831508-8831530 AATACTGAAGCTCAATCATGAGG - Intronic
950951558 3:17005252-17005274 AAGACTGCAGCTCCACAACTTGG + Intronic
951505850 3:23444270-23444292 AAGACTGCAGCTACACAATGGGG - Intronic
951651531 3:24956156-24956178 AATACTGAAGTACTACATTTTGG + Intergenic
953827190 3:46263839-46263861 AATACTGAGGCCCCACATGTTGG - Intronic
957367942 3:79251413-79251435 AATACTGTAGGTCAACAAATTGG + Intronic
958828065 3:99056027-99056049 AACATTGAAGCTCAAGAATTAGG - Intergenic
960399550 3:117179683-117179705 AAGACTGAAGATTCACATTTAGG - Intergenic
960946425 3:122969920-122969942 AATACTGAAGCTCAACCAGCAGG + Intronic
964777836 3:160298176-160298198 AATAAAGAAGCTCCCAAATTAGG + Intronic
965267916 3:166571477-166571499 AACACTGAAGCTGTAAAATTTGG - Intergenic
966746914 3:183285818-183285840 AATTCTGTAGGTCCACATTTAGG + Intronic
967747554 3:193075025-193075047 AATTTTGAAGCTCTACTATTGGG - Intergenic
970364384 4:15343393-15343415 GAAACTGAAGCCCAACAATTGGG + Intronic
970607385 4:17693313-17693335 AATTCTGAAGCTTCACATTGAGG + Exonic
974705077 4:65503955-65503977 GTTACTGATGGTCCACAATTTGG - Intronic
974850422 4:67398075-67398097 AATTCTGCAGGTCAACAATTTGG + Intergenic
975384526 4:73740319-73740341 AATACTGAAGCTCCACAATTTGG - Intergenic
976088105 4:81427083-81427105 AATAATGAAGCTCAACACTGTGG - Exonic
981019847 4:140014041-140014063 ATTACAGATGCTCCACAATGTGG + Intronic
981259575 4:142703866-142703888 ATTTCTGGAGCTCCACCATTTGG + Intronic
983142165 4:164164568-164164590 AATGCTGAATGTTCACAATTAGG + Intronic
986159405 5:5212461-5212483 TATTCTGAAGCTTCATAATTCGG + Intronic
987917314 5:24230693-24230715 AATACTGAAGCACCAGCATTAGG - Intergenic
987943848 5:24578105-24578127 AAGAGTGAAGCTCAACAAATGGG + Intronic
989296976 5:39840303-39840325 AAATCTGAAGGTACACAATTAGG + Intergenic
991319478 5:65354321-65354343 AAAACTGAAGTTCCATAAGTAGG - Intronic
991964916 5:72081362-72081384 AATAATGTAGCTCCAAAATGGGG - Intergenic
995824092 5:116273633-116273655 CATAACGAAGCTTCACAATTTGG - Intronic
998771924 5:145555660-145555682 AATGCTGAAGCTGATCAATTAGG + Intronic
1000158850 5:158579841-158579863 AATTCTGAAGCTCCAGTGTTAGG + Intergenic
1004999415 6:21225516-21225538 AATACAGAAGGTTCACAATAAGG - Intronic
1006103034 6:31698340-31698362 AATACTAAAGCACCACAGTTAGG - Intronic
1007347936 6:41247420-41247442 AAAAGTGAAGCTACCCAATTAGG - Intergenic
1009850344 6:69189137-69189159 GAAACTGAAGTTCCACAATCTGG + Intronic
1012180937 6:96151879-96151901 ATTTCTCAAGCTCCATAATTTGG + Intronic
1012313150 6:97753443-97753465 AGTTCTGAAGCTACAAAATTTGG + Intergenic
1013958109 6:115863911-115863933 AATACTAATGCTCAGCAATTTGG + Intergenic
1015503578 6:133958511-133958533 AATACTGAAGCTACCTAATCAGG + Intronic
1017363820 6:153608798-153608820 CATTCTGAAGCTCTACGATTAGG - Intergenic
1023006693 7:35877863-35877885 AATACAGATGCTCCTCAACTTGG + Intronic
1031415182 7:121486999-121487021 AATAGTGAAGATCCCCTATTTGG - Intergenic
1032181066 7:129678590-129678612 ATTCCTGAAGCCCTACAATTAGG + Intronic
1032967282 7:137113659-137113681 AATACTGAAAATTCACACTTCGG + Intergenic
1033283197 7:140020150-140020172 AATTCTGAACATCCACACTTAGG - Exonic
1039426101 8:37487545-37487567 CTCACTGAAGCTCCAGAATTTGG + Intergenic
1043004376 8:74799941-74799963 AATCCTAAATCTCCACTATTGGG - Intronic
1044629269 8:94262998-94263020 AATGCTGAGGCTCCTCAATCAGG + Intergenic
1044715958 8:95099729-95099751 AAGGCTGAAGCTCCATAACTGGG - Intronic
1046104251 8:109647110-109647132 AATACTGAAACTCCTTAATGTGG + Exonic
1047140104 8:122128901-122128923 AGAACTGAAGTTACACAATTTGG - Intergenic
1048215432 8:132489846-132489868 AGCACTGATGCTCCAGAATTAGG - Intergenic
1057544756 9:96009706-96009728 AATTCTGAAGGCCCAGAATTAGG + Intronic
1060072539 9:120562885-120562907 AATACTAAAGCTCCAAATTTTGG - Intronic
1185996288 X:4953486-4953508 GTTACTGAAGCTCAATAATTTGG + Intergenic
1187722397 X:22165011-22165033 AATCCTGAAGCTCAAGACTTAGG - Intronic
1190441554 X:50480042-50480064 GACACGGAAGCTCCACAATTAGG - Intergenic
1191057605 X:56258648-56258670 TATACTGAACTTCCAGAATTTGG + Intronic
1193548572 X:82860126-82860148 TATACTGATGCTCCCCTATTAGG + Intergenic
1198374177 X:136021357-136021379 TATACTGAAACTGAACAATTAGG - Intronic
1201995375 Y:20081585-20081607 AATAATGAAGCTGCACACCTTGG - Intergenic
1203337219 Y_KI270740v1_random:16785-16807 AATAATGAAGCTGCACACCTTGG + Intergenic
1203337546 Y_KI270740v1_random:21172-21194 AATAATGAAGCTGCACACCTTGG + Intergenic