ID: 975384600

View in Genome Browser
Species Human (GRCh38)
Location 4:73741438-73741460
Sequence GATTATTTGGAGACTATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975384600_975384604 -5 Left 975384600 4:73741438-73741460 CCTTCCATAGTCTCCAAATAATC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 975384604 4:73741456-73741478 TAATCATATTGGAATTAGAAAGG 0: 1
1: 0
2: 1
3: 27
4: 314
975384600_975384605 5 Left 975384600 4:73741438-73741460 CCTTCCATAGTCTCCAAATAATC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 975384605 4:73741466-73741488 GGAATTAGAAAGGAAGTAGCTGG 0: 1
1: 0
2: 4
3: 33
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975384600 Original CRISPR GATTATTTGGAGACTATGGA AGG (reversed) Intronic
901348703 1:8571821-8571843 GATTATTTGGAGATTAACTAAGG - Intronic
901818221 1:11806909-11806931 GGTTATTTGGAGACTATCAGTGG + Intronic
903626552 1:24734835-24734857 GATAATTGGGAGACTGTGGTGGG - Intergenic
904855492 1:33495010-33495032 GATTCTTTGGTGACTAATGAGGG - Exonic
907056369 1:51372480-51372502 GATTATTTGGAAAACATGTATGG + Intronic
910612599 1:89161086-89161108 GATCATTTGCAGGGTATGGATGG - Intronic
913433449 1:118821666-118821688 GATTGTCTGGATATTATGGAGGG - Intergenic
916193451 1:162200649-162200671 AATTCTTTGGAGAATATGGGAGG + Intronic
916664324 1:166951840-166951862 CAATTTTTGGAAACTATGGATGG - Intronic
919720338 1:200826643-200826665 TATTATTTGGAGAGTATTAATGG + Intronic
920632295 1:207664129-207664151 GATTATTTTGATATGATGGAAGG + Intronic
920642645 1:207768677-207768699 GATTATTTTGATATGATGGAAGG + Intronic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG + Intergenic
924815291 1:247436191-247436213 AATTATTTGGAAAATGTGGATGG + Intronic
924948301 1:248860660-248860682 GATTATTTGGATTATAAGGATGG - Intergenic
1071255353 10:83867415-83867437 GATTCTTTGGTGCCTATGGATGG + Intergenic
1072455888 10:95575383-95575405 GGCTATTTAGAGATTATGGAGGG + Intergenic
1073283559 10:102372545-102372567 GATTATGTGGTGTCGATGGAGGG + Intronic
1074715043 10:116210725-116210747 GATTATTTGGAAGCTATTTATGG + Intronic
1075503752 10:123002974-123002996 GATTATTTGGAAAAAATGGATGG + Intronic
1076327078 10:129632659-129632681 GATTCTTTGGTAACTCTGGAAGG + Intronic
1078211670 11:9274910-9274932 GAGTATTTTGAGAGTATGGGTGG + Intergenic
1080569555 11:33543442-33543464 GCTTGTATGGAGAGTATGGAAGG - Exonic
1081279882 11:41196051-41196073 GCTTATTTGGACACAATAGAAGG + Intronic
1081586427 11:44387458-44387480 AATTATTCAGAGAGTATGGAGGG - Intergenic
1088951055 11:114570290-114570312 GATCATTTTAAGACTTTGGAGGG - Intergenic
1089020621 11:115210486-115210508 AATTATTTGGAGACAAGGGAGGG + Intronic
1090575122 11:128094103-128094125 TATTGTTTGGAGACTTTGGCAGG + Intergenic
1091465379 12:679322-679344 GAATATTTGGAGAATAGAGAAGG + Intergenic
1092087258 12:5773291-5773313 GATTATTTAGAGACTTGGCAAGG - Intronic
1097313948 12:58152235-58152257 TGTTATTTTGAGACTTTGGAAGG - Intergenic
1098746196 12:74240286-74240308 CTTTATTTGGAGATTAAGGATGG + Intergenic
1098963972 12:76766276-76766298 GATTATTTTAATACTTTGGATGG + Intronic
1100956159 12:99910987-99911009 TATTATTTGGTGACTTTGTAAGG - Intronic
1101053879 12:100892660-100892682 GATTATTTAAAGTATATGGAAGG - Intronic
1105476888 13:20735758-20735780 GAGTAAATAGAGACTATGGAGGG + Intronic
1105993612 13:25648721-25648743 GATTATTTAAAGTCTATGGGAGG - Intronic
1106509748 13:30402660-30402682 GATTACTTGGTGAATATTGAAGG - Intergenic
1106970900 13:35140475-35140497 GAGTATTATGGGACTATGGAAGG - Intronic
1108809402 13:54202705-54202727 GATTGTGTTGAGAGTATGGACGG + Intergenic
1113419761 13:110162046-110162068 GATTATTTGTAATCAATGGAGGG + Intronic
1116276288 14:42837415-42837437 CATTAAGTGGAGACTATGAAAGG - Intergenic
1124480249 15:30073248-30073270 GATTATTTGGAGATAAAGGAGGG - Intergenic
1125199674 15:37091884-37091906 CATTATTGGGAGACTGGGGAGGG - Intronic
1126806578 15:52355728-52355750 GATGATTTAAAGAATATGGAAGG + Intronic
1128385749 15:67147099-67147121 GATTGTTTGGTAACAATGGAGGG - Intronic
1131822078 15:96283747-96283769 GATCATTTGGAGAGCATTGAAGG - Intergenic
1137652090 16:50129331-50129353 CATTATTTGGAGATTAAGTATGG - Intergenic
1138709034 16:58948503-58948525 GATTATTTGCAGACTATTTATGG - Intergenic
1140355374 16:74301102-74301124 GATTATTTGGAAAACATGTATGG + Exonic
1141090403 16:81126304-81126326 GATCATTTAGAGAACATGGAGGG + Intergenic
1141875288 16:86819905-86819927 GATTATTTGGAGGCGATGCTGGG - Intergenic
1146422314 17:32699207-32699229 GCTTATTTGGAGACTGAGGCAGG - Intronic
1146904591 17:36609765-36609787 GATTGTTGGGAGAATATGGAGGG + Intergenic
1149154891 17:53616417-53616439 CATTATTTGGAGACTTTTGAAGG + Intergenic
1149556910 17:57579961-57579983 TATTATTTGTGGACTATGAATGG - Intronic
1149736497 17:58999522-58999544 GATTATTTAAAGACTTGGGAAGG - Intronic
1150549694 17:66197908-66197930 GATTATTTGGAAAACATGTATGG + Intergenic
1156086908 18:33416635-33416657 GATCATTTGGAAACTATGTGGGG + Intronic
1156605829 18:38665987-38666009 TATTATTTGGGGACTAGGCAGGG + Intergenic
1158258664 18:55584550-55584572 GATTATCTGGAATCTAAGGAGGG - Intronic
1158957925 18:62559270-62559292 GACTATATCCAGACTATGGAAGG + Intronic
1159840285 18:73391276-73391298 GCTGATTTGGAGAATATGGATGG - Intergenic
1161927777 19:7313986-7314008 GATACTTGGGAGGCTATGGAAGG - Intergenic
1163259167 19:16176794-16176816 GATAATTTAAAGTCTATGGAGGG - Intergenic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
925962297 2:9029003-9029025 GATGAGTTGGAGAATTTGGAAGG - Intergenic
927816818 2:26224698-26224720 CTTTATTTGAAGACTATGTATGG + Intronic
929871579 2:45763519-45763541 GGTCCTTTGGAGACTAGGGAGGG - Intronic
935257344 2:101322855-101322877 GATTAGCTGAAAACTATGGAAGG - Intergenic
937939936 2:127277291-127277313 GGTTATGTGAAGACTTTGGAGGG + Intronic
938018062 2:127884816-127884838 GATTTCTTCGAGACTAAGGATGG - Intronic
938465811 2:131524254-131524276 GTTTATTTGGAGAGTAAGTATGG + Intergenic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
940358549 2:152771698-152771720 GATTATTTAAAGCCTATTGAAGG - Intergenic
941003802 2:160226898-160226920 AAATACTTGGAGACTATGGATGG + Intronic
942549147 2:177096307-177096329 ATTTATTTGTATACTATGGAAGG - Intergenic
945351064 2:208781088-208781110 CATTATTTTGACAATATGGATGG + Intronic
948289192 2:236812313-236812335 GATCATTTAAAGTCTATGGAAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1173707880 20:45125757-45125779 GATCATTTGGATACCAGGGATGG + Intergenic
1174485453 20:50858259-50858281 GATGATTTAGAGTATATGGAAGG - Intronic
1174975882 20:55333220-55333242 AATTATTAGGAGAATATGGAAGG - Intergenic
1177233679 21:18357478-18357500 GATTATATAGAGACAATGTAAGG - Intronic
1177470048 21:21548781-21548803 TATTTTTTGGAGACTTTGGCAGG - Intergenic
1178095644 21:29212306-29212328 GGTTAAATGGAGACTATGGAAGG - Intronic
1178191773 21:30290796-30290818 GCTTACTTGAATACTATGGAAGG + Intergenic
1181013446 22:20055369-20055391 GCTAATCTGGAGACTAAGGAGGG - Intronic
949237210 3:1823694-1823716 TATCTTTTGTAGACTATGGAGGG + Intergenic
949615022 3:5744203-5744225 CTTTATTTGGAGATTATGTATGG + Intergenic
949737092 3:7185840-7185862 CATGATTTGGAGACTTTGAAGGG - Intronic
951645196 3:24882416-24882438 GATGATTTGAAGTATATGGAAGG + Intergenic
955234720 3:57129669-57129691 GCATATTTGGAAATTATGGAAGG + Intronic
955418339 3:58713532-58713554 GGTTATTTGGAGATTACGTATGG - Intergenic
957427405 3:80056033-80056055 ACTTATTTGGAAAATATGGATGG - Intergenic
959495753 3:107049361-107049383 GATTATTTGGGGTCTAGAGAAGG - Intergenic
960883856 3:122374452-122374474 GATTATTTAAAGTATATGGAAGG - Intronic
962052116 3:131827189-131827211 GATTATTTGGTGTCTTTGGTTGG - Intronic
962654437 3:137528948-137528970 GATGATTTGAAGTATATGGAAGG + Intergenic
967164104 3:186765313-186765335 TATTATTTGTAGACTTTGTATGG - Intergenic
970631347 4:17949481-17949503 GGTTATTGGGAGACTATTCAGGG - Intronic
971303559 4:25461616-25461638 TTTTATTTGGAGACCATGGTAGG + Intergenic
973028576 4:45305953-45305975 CTTTATTTGGAGACTATATATGG + Intergenic
973577993 4:52312159-52312181 AAATATTTGGAGATTAGGGAAGG - Intergenic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
977492523 4:97732641-97732663 AAATATTTGGAAACTATGGATGG + Intronic
978066370 4:104407809-104407831 GATTATTTGGTGATTCTGCATGG - Intergenic
979568270 4:122182399-122182421 GATGATTTGGAAACTGTGTATGG - Intronic
979585809 4:122415570-122415592 GTTTCTTTGGAGATTGTGGATGG + Exonic
979595423 4:122529261-122529283 CTTTATTTGGAGATTAAGGATGG - Intergenic
982435692 4:155382122-155382144 GAATGTTTGTAGAATATGGAGGG - Intergenic
982616934 4:157650506-157650528 GATTATTTGAAGGATATGGTTGG + Intergenic
983691096 4:170469861-170469883 GTTAATTTGGAGAATCTGGATGG - Intergenic
984115452 4:175675136-175675158 TATTATTTGGAGCATATGTATGG - Intronic
985016897 4:185645651-185645673 GATTTCTTGGAGACTCTTGAAGG + Intronic
988377868 5:30460988-30461010 GATTAATTTGAATCTATGGATGG - Intergenic
988384786 5:30547930-30547952 GAATCTTTGGAAACTATGGGTGG - Intergenic
992835588 5:80638050-80638072 GATTATTTGACTAGTATGGATGG - Intronic
993244883 5:85438076-85438098 GATCATTTTGGGAATATGGAAGG + Intergenic
993328664 5:86570097-86570119 GATTTAATGGAGACTATGTATGG - Intergenic
994802961 5:104402590-104402612 GATTATTTTGAAACCATTGATGG - Intergenic
995530712 5:113089322-113089344 GATAATGGGGAGACTCTGGAAGG + Intronic
998964404 5:147523522-147523544 GATTATTTAGAATGTATGGAGGG - Intergenic
999687145 5:154113126-154113148 AATTATTAGTAGACCATGGATGG - Intronic
1000381961 5:160637244-160637266 GAGTATATGGAGTATATGGATGG - Intronic
1000422546 5:161055111-161055133 CTTTATTTGGAGATTATGAAAGG - Intergenic
1006040133 6:31245398-31245420 TTTTATTTGGAGACTAAGTATGG - Intergenic
1006967862 6:38007876-38007898 AATTTTTGGGAGACTGTGGAAGG + Intronic
1008423228 6:51327283-51327305 AATTTTTTGGGGACCATGGAAGG + Intergenic
1010058571 6:71593930-71593952 GATAATTTGGAGTCTAAGCATGG + Intergenic
1013356769 6:109352094-109352116 AATTATTTGGAGACAATGTGAGG - Intergenic
1013636026 6:112030127-112030149 AATTATTCTGAGACTGTGGATGG - Intergenic
1014108426 6:117592885-117592907 GATAAATTGAAGACTAAGGAAGG - Intronic
1015221670 6:130811329-130811351 GAGTATTTGGAGGTTCTGGAAGG - Intergenic
1015686765 6:135871921-135871943 GATTCTTAGGAAACTATGAATGG + Intronic
1018370334 6:163162425-163162447 GATTATTTGGAGGCATTTGAGGG - Intronic
1020584139 7:10044829-10044851 AATTATTTTGAGACTTTGGGGGG - Intergenic
1020962306 7:14820542-14820564 AATTATTTGGAAACTATAAATGG - Intronic
1022743797 7:33149105-33149127 GATGATTTGGAGACCATGGAGGG + Intronic
1025097914 7:56111578-56111600 GATACTTGGGAGACTATGGTGGG + Intergenic
1025583758 7:62754549-62754571 GATTTTTAGGAGCCCATGGAGGG + Intergenic
1025598015 7:62956094-62956116 GATATTTGGAAGACTATGGAAGG + Intergenic
1027905095 7:84169680-84169702 GATTAATTGTAGACTATCTATGG - Intronic
1028359827 7:89954560-89954582 GATTATTTTAAGTCTAAGGATGG - Intergenic
1030321013 7:108167501-108167523 GATTAATTGGATACGTTGGAAGG - Intronic
1030503416 7:110388004-110388026 AATGATTTGGAGACTAGGGAAGG + Intergenic
1030654986 7:112157542-112157564 AATTATTTGGAGATAATGTAAGG + Intronic
1031461746 7:122059496-122059518 TATTATTTGTATACTATGAAAGG - Intronic
1032287075 7:130547034-130547056 ACTTATTTGGAGACTTGGGAAGG - Intronic
1033986592 7:147234170-147234192 AAGTATTTGGAGATGATGGATGG - Intronic
1037212376 8:16406494-16406516 GGTTATGTGGACACTCTGGATGG + Intronic
1039439459 8:37584629-37584651 GCCTATTTGGAGACAATGGGTGG - Intergenic
1043877980 8:85508218-85508240 GATCATTTAAAGAATATGGAAGG - Intergenic
1044461851 8:92454736-92454758 GATTATATGGAGAATAAGTAAGG + Intergenic
1046241648 8:111503199-111503221 GAATATTTCTAGATTATGGATGG - Intergenic
1051310938 9:15771468-15771490 GATCATTTGTAGAATATGAATGG - Intronic
1052462438 9:28783309-28783331 GATTATATGAAGAATATGGGAGG - Intergenic
1059661578 9:116407037-116407059 GAATATTTGGATACTCTGTAAGG - Intergenic
1059871264 9:118580644-118580666 GGTGATTTTGAGATTATGGAAGG + Intergenic
1185576561 X:1179290-1179312 GAGTATTTGGAGGCTAGAGACGG - Intergenic
1185576570 X:1179375-1179397 GAGTATTTGGAGGCTAGAGACGG - Intergenic
1188523068 X:31059888-31059910 GATTATTTGGAGATTTGGGGAGG + Intergenic
1191228789 X:58077174-58077196 GTTTTTGTGGAAACTATGGAGGG - Intergenic
1193776677 X:85650796-85650818 AATTATTTTGAGACTTAGGAGGG - Intergenic
1194403481 X:93466420-93466442 GATTATTTAAAGTATATGGATGG + Intergenic
1197163578 X:123350954-123350976 GATTTGTTGGAGATGATGGATGG - Intronic
1198836338 X:140808644-140808666 GATTATTTCTGGATTATGGATGG + Intergenic
1201552249 Y:15229856-15229878 GATGATTTGGATACAATAGATGG + Intergenic