ID: 975386616

View in Genome Browser
Species Human (GRCh38)
Location 4:73766720-73766742
Sequence TTGGGCAATGACAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975386604_975386616 6 Left 975386604 4:73766691-73766713 CCACCATGGCCACTTTGCTCACG No data
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386603_975386616 10 Left 975386603 4:73766687-73766709 CCTGCCACCATGGCCACTTTGCT No data
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386608_975386616 -3 Left 975386608 4:73766700-73766722 CCACTTTGCTCACGGGCCCATTG No data
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386607_975386616 3 Left 975386607 4:73766694-73766716 CCATGGCCACTTTGCTCACGGGC No data
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386597_975386616 29 Left 975386597 4:73766668-73766690 CCCATGTGTAACCTCCATCCCTG 0: 62
1: 127
2: 173
3: 180
4: 317
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386598_975386616 28 Left 975386598 4:73766669-73766691 CCATGTGTAACCTCCATCCCTGC 0: 64
1: 132
2: 179
3: 209
4: 422
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386600_975386616 18 Left 975386600 4:73766679-73766701 CCTCCATCCCTGCCACCATGGCC 0: 179
1: 213
2: 209
3: 260
4: 1022
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386602_975386616 11 Left 975386602 4:73766686-73766708 CCCTGCCACCATGGCCACTTTGC No data
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data
975386601_975386616 15 Left 975386601 4:73766682-73766704 CCATCCCTGCCACCATGGCCACT 0: 184
1: 239
2: 223
3: 215
4: 751
Right 975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975386616 Original CRISPR TTGGGCAATGACAGGGTGGC TGG Intergenic
No off target data available for this crispr