ID: 975386716

View in Genome Browser
Species Human (GRCh38)
Location 4:73767501-73767523
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975386716_975386719 15 Left 975386716 4:73767501-73767523 CCAGTAACAGGCCAAAAGCTGTC No data
Right 975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG No data
975386716_975386718 11 Left 975386716 4:73767501-73767523 CCAGTAACAGGCCAAAAGCTGTC No data
Right 975386718 4:73767535-73767557 GAGTAGTTATCTACAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975386716 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr