ID: 975386719

View in Genome Browser
Species Human (GRCh38)
Location 4:73767539-73767561
Sequence AGTTATCTACAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975386715_975386719 16 Left 975386715 4:73767500-73767522 CCCAGTAACAGGCCAAAAGCTGT No data
Right 975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG No data
975386714_975386719 22 Left 975386714 4:73767494-73767516 CCAAAGCCCAGTAACAGGCCAAA No data
Right 975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG No data
975386716_975386719 15 Left 975386716 4:73767501-73767523 CCAGTAACAGGCCAAAAGCTGTC No data
Right 975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG No data
975386717_975386719 4 Left 975386717 4:73767512-73767534 CCAAAAGCTGTCTCTCAAAAGAA No data
Right 975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975386719 Original CRISPR AGTTATCTACAGAAGATGGC AGG Intergenic
No off target data available for this crispr