ID: 975389158

View in Genome Browser
Species Human (GRCh38)
Location 4:73796515-73796537
Sequence TGTTAGTTTGCTGACAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975389158_975389161 19 Left 975389158 4:73796515-73796537 CCATAATTGTCAGCAAACTAACA No data
Right 975389161 4:73796557-73796579 ACCGCATGCTCTCACTCATAAGG No data
975389158_975389163 20 Left 975389158 4:73796515-73796537 CCATAATTGTCAGCAAACTAACA No data
Right 975389163 4:73796558-73796580 CCGCATGCTCTCACTCATAAGGG No data
975389158_975389164 21 Left 975389158 4:73796515-73796537 CCATAATTGTCAGCAAACTAACA No data
Right 975389164 4:73796559-73796581 CGCATGCTCTCACTCATAAGGGG No data
975389158_975389165 22 Left 975389158 4:73796515-73796537 CCATAATTGTCAGCAAACTAACA No data
Right 975389165 4:73796560-73796582 GCATGCTCTCACTCATAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975389158 Original CRISPR TGTTAGTTTGCTGACAATTA TGG (reversed) Intergenic