ID: 975389161

View in Genome Browser
Species Human (GRCh38)
Location 4:73796557-73796579
Sequence ACCGCATGCTCTCACTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975389158_975389161 19 Left 975389158 4:73796515-73796537 CCATAATTGTCAGCAAACTAACA No data
Right 975389161 4:73796557-73796579 ACCGCATGCTCTCACTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975389161 Original CRISPR ACCGCATGCTCTCACTCATA AGG Intergenic