ID: 975394990

View in Genome Browser
Species Human (GRCh38)
Location 4:73864254-73864276
Sequence ACTCAAGCTCTGTATTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975394990_975394998 10 Left 975394990 4:73864254-73864276 CCCCTAAAATACAGAGCTTGAGT No data
Right 975394998 4:73864287-73864309 CCATGCATGTAATTGATTTGGGG No data
975394990_975394999 30 Left 975394990 4:73864254-73864276 CCCCTAAAATACAGAGCTTGAGT No data
Right 975394999 4:73864307-73864329 GGGAAATGTTCCCAACACAGAGG No data
975394990_975394995 8 Left 975394990 4:73864254-73864276 CCCCTAAAATACAGAGCTTGAGT No data
Right 975394995 4:73864285-73864307 TGCCATGCATGTAATTGATTTGG No data
975394990_975394996 9 Left 975394990 4:73864254-73864276 CCCCTAAAATACAGAGCTTGAGT No data
Right 975394996 4:73864286-73864308 GCCATGCATGTAATTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975394990 Original CRISPR ACTCAAGCTCTGTATTTTAG GGG (reversed) Intergenic
No off target data available for this crispr