ID: 975397170

View in Genome Browser
Species Human (GRCh38)
Location 4:73889905-73889927
Sequence ATATATAATCTATATATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975397166_975397170 30 Left 975397166 4:73889852-73889874 CCTTCTCCAAAATATATACTCTA No data
Right 975397170 4:73889905-73889927 ATATATAATCTATATATGAGTGG No data
975397167_975397170 24 Left 975397167 4:73889858-73889880 CCAAAATATATACTCTAAATTAG No data
Right 975397170 4:73889905-73889927 ATATATAATCTATATATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975397170 Original CRISPR ATATATAATCTATATATGAG TGG Intergenic
No off target data available for this crispr