ID: 975404078

View in Genome Browser
Species Human (GRCh38)
Location 4:73969068-73969090
Sequence AAGGAACATTGATTGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975404078_975404081 20 Left 975404078 4:73969068-73969090 CCAAGAGGCAATCAATGTTCCTT No data
Right 975404081 4:73969111-73969133 GTTCTGTCTCTTCTGTTCACAGG No data
975404078_975404084 26 Left 975404078 4:73969068-73969090 CCAAGAGGCAATCAATGTTCCTT No data
Right 975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG No data
975404078_975404083 25 Left 975404078 4:73969068-73969090 CCAAGAGGCAATCAATGTTCCTT No data
Right 975404083 4:73969116-73969138 GTCTCTTCTGTTCACAGGCTGGG No data
975404078_975404082 24 Left 975404078 4:73969068-73969090 CCAAGAGGCAATCAATGTTCCTT No data
Right 975404082 4:73969115-73969137 TGTCTCTTCTGTTCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975404078 Original CRISPR AAGGAACATTGATTGCCTCT TGG (reversed) Intergenic
No off target data available for this crispr