ID: 975404079

View in Genome Browser
Species Human (GRCh38)
Location 4:73969087-73969109
Sequence TTGTTGTGACAGTGGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975404079_975404086 26 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404086 4:73969136-73969158 GGGGAAGAAACTGAGCCTGAGGG No data
975404079_975404082 5 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404082 4:73969115-73969137 TGTCTCTTCTGTTCACAGGCTGG No data
975404079_975404084 7 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG No data
975404079_975404083 6 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404083 4:73969116-73969138 GTCTCTTCTGTTCACAGGCTGGG No data
975404079_975404081 1 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404081 4:73969111-73969133 GTTCTGTCTCTTCTGTTCACAGG No data
975404079_975404085 25 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404085 4:73969135-73969157 TGGGGAAGAAACTGAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975404079 Original CRISPR TTGTTGTGACAGTGGCAGAA AGG (reversed) Intergenic