ID: 975404082

View in Genome Browser
Species Human (GRCh38)
Location 4:73969115-73969137
Sequence TGTCTCTTCTGTTCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975404078_975404082 24 Left 975404078 4:73969068-73969090 CCAAGAGGCAATCAATGTTCCTT No data
Right 975404082 4:73969115-73969137 TGTCTCTTCTGTTCACAGGCTGG No data
975404080_975404082 -3 Left 975404080 4:73969095-73969117 CCACTGTCACAACAATGTTCTGT No data
Right 975404082 4:73969115-73969137 TGTCTCTTCTGTTCACAGGCTGG No data
975404079_975404082 5 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404082 4:73969115-73969137 TGTCTCTTCTGTTCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975404082 Original CRISPR TGTCTCTTCTGTTCACAGGC TGG Intergenic
No off target data available for this crispr