ID: 975404083

View in Genome Browser
Species Human (GRCh38)
Location 4:73969116-73969138
Sequence GTCTCTTCTGTTCACAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975404079_975404083 6 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404083 4:73969116-73969138 GTCTCTTCTGTTCACAGGCTGGG No data
975404080_975404083 -2 Left 975404080 4:73969095-73969117 CCACTGTCACAACAATGTTCTGT No data
Right 975404083 4:73969116-73969138 GTCTCTTCTGTTCACAGGCTGGG No data
975404078_975404083 25 Left 975404078 4:73969068-73969090 CCAAGAGGCAATCAATGTTCCTT No data
Right 975404083 4:73969116-73969138 GTCTCTTCTGTTCACAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975404083 Original CRISPR GTCTCTTCTGTTCACAGGCT GGG Intergenic
No off target data available for this crispr