ID: 975404084

View in Genome Browser
Species Human (GRCh38)
Location 4:73969117-73969139
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975404079_975404084 7 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG No data
975404080_975404084 -1 Left 975404080 4:73969095-73969117 CCACTGTCACAACAATGTTCTGT No data
Right 975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG No data
975404078_975404084 26 Left 975404078 4:73969068-73969090 CCAAGAGGCAATCAATGTTCCTT No data
Right 975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type