ID: 975404086

View in Genome Browser
Species Human (GRCh38)
Location 4:73969136-73969158
Sequence GGGGAAGAAACTGAGCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975404079_975404086 26 Left 975404079 4:73969087-73969109 CCTTTCTGCCACTGTCACAACAA No data
Right 975404086 4:73969136-73969158 GGGGAAGAAACTGAGCCTGAGGG No data
975404080_975404086 18 Left 975404080 4:73969095-73969117 CCACTGTCACAACAATGTTCTGT No data
Right 975404086 4:73969136-73969158 GGGGAAGAAACTGAGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975404086 Original CRISPR GGGGAAGAAACTGAGCCTGA GGG Intergenic
No off target data available for this crispr