ID: 975408414

View in Genome Browser
Species Human (GRCh38)
Location 4:74018883-74018905
Sequence TCGGCACTGCTGCCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975408411_975408414 -5 Left 975408411 4:74018865-74018887 CCAGGCTCCTCCTAGCTGTCGGC No data
Right 975408414 4:74018883-74018905 TCGGCACTGCTGCCACAAACTGG No data
975408406_975408414 23 Left 975408406 4:74018837-74018859 CCATCCTGTCTCTCATTCTCATC No data
Right 975408414 4:74018883-74018905 TCGGCACTGCTGCCACAAACTGG No data
975408408_975408414 19 Left 975408408 4:74018841-74018863 CCTGTCTCTCATTCTCATCAGGT No data
Right 975408414 4:74018883-74018905 TCGGCACTGCTGCCACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975408414 Original CRISPR TCGGCACTGCTGCCACAAAC TGG Intergenic
No off target data available for this crispr