ID: 975413572

View in Genome Browser
Species Human (GRCh38)
Location 4:74083013-74083035
Sequence TATAGGAGAAAAAGAGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975413572_975413575 1 Left 975413572 4:74083013-74083035 CCATGATCTCTTTTTCTCCTATA No data
Right 975413575 4:74083037-74083059 ATAAACAAGCATTGTACCTAGGG 0: 19
1: 66
2: 85
3: 80
4: 168
975413572_975413577 28 Left 975413572 4:74083013-74083035 CCATGATCTCTTTTTCTCCTATA No data
Right 975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG No data
975413572_975413574 0 Left 975413572 4:74083013-74083035 CCATGATCTCTTTTTCTCCTATA No data
Right 975413574 4:74083036-74083058 CATAAACAAGCATTGTACCTAGG No data
975413572_975413578 29 Left 975413572 4:74083013-74083035 CCATGATCTCTTTTTCTCCTATA No data
Right 975413578 4:74083065-74083087 ACGTTCCTCCTCTTTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975413572 Original CRISPR TATAGGAGAAAAAGAGATCA TGG (reversed) Intergenic
No off target data available for this crispr