ID: 975413573

View in Genome Browser
Species Human (GRCh38)
Location 4:74083030-74083052
Sequence TACAATGCTTGTTTATGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975413573_975413577 11 Left 975413573 4:74083030-74083052 CCTATACATAAACAAGCATTGTA No data
Right 975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG No data
975413573_975413578 12 Left 975413573 4:74083030-74083052 CCTATACATAAACAAGCATTGTA No data
Right 975413578 4:74083065-74083087 ACGTTCCTCCTCTTTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975413573 Original CRISPR TACAATGCTTGTTTATGTAT AGG (reversed) Intergenic
No off target data available for this crispr