ID: 975413577

View in Genome Browser
Species Human (GRCh38)
Location 4:74083064-74083086
Sequence CACGTTCCTCCTCTTTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975413571_975413577 29 Left 975413571 4:74083012-74083034 CCCATGATCTCTTTTTCTCCTAT No data
Right 975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG No data
975413572_975413577 28 Left 975413572 4:74083013-74083035 CCATGATCTCTTTTTCTCCTATA No data
Right 975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG No data
975413573_975413577 11 Left 975413573 4:74083030-74083052 CCTATACATAAACAAGCATTGTA No data
Right 975413577 4:74083064-74083086 CACGTTCCTCCTCTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975413577 Original CRISPR CACGTTCCTCCTCTTTCTTT TGG Intergenic
No off target data available for this crispr