ID: 975415551

View in Genome Browser
Species Human (GRCh38)
Location 4:74100076-74100098
Sequence GTGCTGTCCCTGGGCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975415547_975415551 8 Left 975415547 4:74100045-74100067 CCTGTTGGGCTCAGGAGGTCTGC No data
Right 975415551 4:74100076-74100098 GTGCTGTCCCTGGGCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975415551 Original CRISPR GTGCTGTCCCTGGGCAGAAA AGG Intergenic
No off target data available for this crispr