ID: 975416954

View in Genome Browser
Species Human (GRCh38)
Location 4:74115549-74115571
Sequence CTGACAGAGCACCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975416954_975416956 -4 Left 975416954 4:74115549-74115571 CCCTTGAGGGGGTGCTCTGTCAG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 975416956 4:74115568-74115590 TCAGTATGAACATGCCTTCATGG No data
975416954_975416957 -3 Left 975416954 4:74115549-74115571 CCCTTGAGGGGGTGCTCTGTCAG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 975416957 4:74115569-74115591 CAGTATGAACATGCCTTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 118
975416954_975416958 8 Left 975416954 4:74115549-74115571 CCCTTGAGGGGGTGCTCTGTCAG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 975416958 4:74115580-74115602 TGCCTTCATGGGCAGAAATTAGG 0: 1
1: 0
2: 2
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975416954 Original CRISPR CTGACAGAGCACCCCCTCAA GGG (reversed) Intronic
902566650 1:17315849-17315871 TTGAGAGAGCAGCCCCTGAATGG - Intronic
904129612 1:28265875-28265897 CTCAAAGACCACCTCCTCAATGG + Intronic
905916563 1:41688698-41688720 CTGACAGAGAAGCACCTCCAAGG + Intronic
906132269 1:43467794-43467816 ATGAGAGAGCACCCCCACATTGG + Intergenic
907510208 1:54952406-54952428 CTGACAGAGCAGCCCACCAAGGG - Intergenic
907737245 1:57126406-57126428 TGGACAGGGCACCCCCTCACTGG + Intronic
908142251 1:61198437-61198459 CAGAGAGAGCACCCCCTGCAAGG + Intronic
913513820 1:119585918-119585940 CACACACAGCACACCCTCAAAGG + Intergenic
914984335 1:152443107-152443129 CTGACAGACCAACCCCTCCCAGG - Intergenic
917124344 1:171672936-171672958 CTGAAAGCGTACCCCCTCAGGGG - Intergenic
917669355 1:177257564-177257586 CTCACAGAGCACCCACTCTGAGG + Intronic
920362301 1:205427521-205427543 CAGACAGAGCGCACACTCAAGGG + Intronic
923032038 1:230256916-230256938 CTCACATAACACCTCCTCAAAGG - Intronic
923599294 1:235387902-235387924 TAGACAGAGCAGCCCCTCCAGGG + Intronic
1063016248 10:2080624-2080646 CTGACAGAGCCCCTCACCAAGGG - Intergenic
1063618799 10:7626028-7626050 TGGACAGAGCAGCCCTTCAAGGG + Intronic
1070766855 10:79061711-79061733 CTGACGGTGCAGCCCCTCCACGG - Intergenic
1072766234 10:98097206-98097228 CTCACAGAGCTCCCCCAGAATGG + Intergenic
1075940961 10:126389547-126389569 CTGACGGAGCACCCACTCCTAGG + Intergenic
1078151903 11:8766574-8766596 CTGACAGACCATCCACTGAAAGG + Intronic
1079003540 11:16777003-16777025 CTGACAAACCAGCCCCACAAGGG + Intergenic
1085154893 11:74284441-74284463 CTGACAGAGCAGCCTCTGTATGG - Intronic
1085694936 11:78696161-78696183 CAGAGAGAGCAGCCCATCAAAGG + Intronic
1093566651 12:20614443-20614465 CTGACTGACCACCAGCTCAAAGG - Intronic
1093779242 12:23114802-23114824 CTGACAGAGCATTCCCTGAAAGG + Intergenic
1096631188 12:52927625-52927647 CTGACTGAGCACCCCCTTGTGGG + Intronic
1100585168 12:95972703-95972725 CTGACAGCACACGCCTTCAAGGG - Exonic
1100923864 12:99521804-99521826 CTGACAGAGCACAGTTTCAATGG - Intronic
1102475740 12:113186983-113187005 CTGTGAGACCACCCCCTCAAGGG + Exonic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108988806 13:56629350-56629372 CGGACAGACCACCTCCTCAAGGG + Intergenic
1109764932 13:66882665-66882687 CTCACAAAGCAGCCACTCAATGG + Intronic
1114500912 14:23167664-23167686 CTTTCAAAGCACCCACTCAATGG - Intronic
1117326370 14:54672507-54672529 ATGACAGGGCACCCTCTCAGGGG - Intronic
1118870055 14:69733998-69734020 CTGTCAGACCAACTCCTCAAAGG - Intronic
1123105506 14:105839437-105839459 CTCACAGAGAACCCCCTCTGAGG - Intergenic
1126099914 15:45112815-45112837 CTGACAGAACCTTCCCTCAAGGG + Intronic
1128004272 15:64224024-64224046 CTGAAATAGAACCACCTCAAAGG + Intronic
1132679981 16:1135915-1135937 CTAACCGTGCACCCCCTCCAAGG + Intergenic
1133315040 16:4877599-4877621 CTGACAAAGCACAGCCTCAAAGG - Intronic
1134251027 16:12573989-12574011 CTCCCAGTGCACCCCCTTAAGGG + Exonic
1138629807 16:58284489-58284511 CTCACAGAGCTCCCCATCTAGGG + Intronic
1142423885 16:89990461-89990483 CTGACAGAGCCCCCTCTCGCAGG - Intergenic
1146884557 17:36462434-36462456 GGGGCAGAGCAGCCCCTCAAGGG + Intergenic
1151057838 17:71054068-71054090 ATGACTTAGCACCCCCTCTAGGG - Intergenic
1152443918 17:80329208-80329230 TTGGCAGAGCACACCCTCACTGG + Intronic
1158626938 18:59079745-59079767 CTGCCAGAGCTACCCCTGAATGG + Intergenic
1163405195 19:17117552-17117574 TTTACAGAGAACCCCCTCTAGGG - Intronic
1165733835 19:38163570-38163592 CTCAAAGGTCACCCCCTCAAAGG - Intronic
1166805525 19:45484802-45484824 CTGACAGACCACCCATTCCAGGG - Intergenic
936073927 2:109389817-109389839 CTGACAGTGCACCCCCATCAGGG - Intronic
940279513 2:151975145-151975167 CTGACAAAGCAGCTTCTCAATGG - Intronic
942324437 2:174764216-174764238 CTGACAGAGCAGCCCCTGGTTGG + Intronic
944740578 2:202608175-202608197 CTGACAGAGCATCCTTTCAATGG - Intergenic
1169203946 20:3729866-3729888 CAGACACAGCACCCACACAAGGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1176002973 20:62841986-62842008 TTTACAGAGCAGCCCCTCGATGG - Exonic
1180231824 21:46430952-46430974 CAGACAGAGCACAGCCTCAGAGG + Intronic
1183986839 22:41574819-41574841 CTGAGTGAGCACCACCTCCACGG - Exonic
1185093895 22:48795290-48795312 CACACACAGCATCCCCTCAAGGG - Intronic
949594531 3:5530462-5530484 GTGACAGACTACCTCCTCAAGGG - Intergenic
950914311 3:16628279-16628301 CTGACAGAGCAGCCCCCATATGG - Intronic
952626117 3:35405703-35405725 CTGACAGAGCCAGACCTCAACGG + Intergenic
953034344 3:39198956-39198978 CTGAAACAGCACCCAATCAATGG - Intergenic
960731197 3:120729069-120729091 CTGACTGGGCACCTCATCAAAGG - Intronic
961726694 3:128935372-128935394 CTGACAGCGCACCCTCACCACGG - Intronic
963228789 3:142889149-142889171 CTGCCAGAGCAGCTCCTCAGGGG - Exonic
963444570 3:145387741-145387763 CTGACTGAGCACCCCTTCTGTGG - Intergenic
965360715 3:167735200-167735222 CTGTCAGCCCGCCCCCTCAATGG - Intergenic
967215879 3:187209890-187209912 TTGACAGAGGACCAGCTCAATGG + Intergenic
969905959 4:10396217-10396239 CAGTCAGAGCACCCACTCACTGG - Intergenic
975416954 4:74115549-74115571 CTGACAGAGCACCCCCTCAAGGG - Intronic
985142067 4:186850611-186850633 ATGACAGAGCACCTTCTAAATGG - Intergenic
985328757 4:188803140-188803162 CTGACATGGGACCCCATCAAAGG - Intergenic
990731824 5:58816965-58816987 CTGACAGAGCAACCCCTTTCTGG + Intronic
991414707 5:66380077-66380099 GGGACAGAGCACCACATCAAGGG + Intergenic
992490190 5:77235072-77235094 CTCACAGAGCAGCCCCACAGAGG + Intronic
1001088891 5:168722441-168722463 TTGACAGAACATCCCCTAAAGGG + Intronic
1001658908 5:173375696-173375718 CTTACAGAGCACCCTTTGAAGGG + Intergenic
1002294769 5:178224195-178224217 GTCAGAGAGCACCCCCTCCAAGG + Intronic
1004096641 6:12561170-12561192 GTGAAAGAGCACCACATCAAGGG + Intergenic
1007721457 6:43887716-43887738 CAGAGAGAGAACCCCCTCAGGGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1016998421 6:149977359-149977381 CTGCCAGCCCAGCCCCTCAAAGG + Intergenic
1017908177 6:158771036-158771058 CTGACGGAGCAGCCGCTCCAGGG + Intronic
1019650607 7:2155830-2155852 CTGACAGAGCATCCCCTTTTCGG + Intronic
1021748652 7:23772614-23772636 GTGACAGGGTACCCCCTCGAAGG + Intronic
1022493370 7:30837618-30837640 ATGACAGAGCACCTCCTCCCAGG - Intronic
1034175855 7:149099237-149099259 CTCACGGAGCTCCCCCTCAGTGG - Intergenic
1034545952 7:151789514-151789536 CTTAAAGAGCAACCCCTGAAAGG + Intronic
1039221098 8:35331615-35331637 GAGTCAGAGCACCCCCTCCAAGG - Intronic
1040342375 8:46447455-46447477 CTCACAGAAGACCCCCACAAGGG - Intergenic
1041682240 8:60605334-60605356 CTCACAGAGCACCTCTTCTAGGG + Intronic
1044603863 8:94032345-94032367 CTGATAAAGCAGCCACTCAATGG + Intergenic
1045450863 8:102323637-102323659 CTGAAAAAGCACCACCTTAAAGG + Intronic
1055290518 9:74778173-74778195 CTGAAAGGGCACCCCCACCAGGG + Intronic
1056329185 9:85507884-85507906 GTGACATGGTACCCCCTCAAGGG + Intergenic
1056562842 9:87747581-87747603 CTTATAGAGCATCCCTTCAATGG - Intergenic
1057275556 9:93674368-93674390 CTGTCAGAGCCCACCCTCCATGG + Intronic
1062567852 9:137171231-137171253 GGGACAGTGCACCCCCACAAAGG + Intronic
1187960591 X:24563405-24563427 CAGACAGAGCACCCCAAGAAAGG + Intronic
1190912081 X:54782075-54782097 CTGTCAGAGCACCCTCTGGAGGG + Intronic
1197823236 X:130562853-130562875 CAGACAGAGCACCCTCACTAGGG - Intergenic
1200544063 Y:4497691-4497713 ATGCCTGAGCACCCCCTCCACGG - Intergenic