ID: 975417449 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:74121401-74121423 |
| Sequence | AAACCCTACTTCACAAAGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 240 | |||
| Summary | {0: 1, 1: 22, 2: 35, 3: 34, 4: 148} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 975417449_975417450 | 10 | Left | 975417449 | 4:74121401-74121423 | CCTATCTTTGTGAAGTAGGGTTT | 0: 1 1: 22 2: 35 3: 34 4: 148 |
||
| Right | 975417450 | 4:74121434-74121456 | CAGCAACCACAATGAGATTATGG | 0: 1 1: 9 2: 12 3: 27 4: 150 |
||||
| 975417449_975417452 | 20 | Left | 975417449 | 4:74121401-74121423 | CCTATCTTTGTGAAGTAGGGTTT | 0: 1 1: 22 2: 35 3: 34 4: 148 |
||
| Right | 975417452 | 4:74121444-74121466 | AATGAGATTATGGAGTAGACTGG | 0: 9 1: 12 2: 13 3: 54 4: 236 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 975417449 | Original CRISPR | AAACCCTACTTCACAAAGAT AGG (reversed) | Intronic | ||