ID: 975417449

View in Genome Browser
Species Human (GRCh38)
Location 4:74121401-74121423
Sequence AAACCCTACTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 22, 2: 35, 3: 34, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975417449_975417450 10 Left 975417449 4:74121401-74121423 CCTATCTTTGTGAAGTAGGGTTT 0: 1
1: 22
2: 35
3: 34
4: 148
Right 975417450 4:74121434-74121456 CAGCAACCACAATGAGATTATGG 0: 1
1: 9
2: 12
3: 27
4: 150
975417449_975417452 20 Left 975417449 4:74121401-74121423 CCTATCTTTGTGAAGTAGGGTTT 0: 1
1: 22
2: 35
3: 34
4: 148
Right 975417452 4:74121444-74121466 AATGAGATTATGGAGTAGACTGG 0: 9
1: 12
2: 13
3: 54
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975417449 Original CRISPR AAACCCTACTTCACAAAGAT AGG (reversed) Intronic