ID: 975421353

View in Genome Browser
Species Human (GRCh38)
Location 4:74167700-74167722
Sequence CTGAAGATCTGGAGAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975421353 Original CRISPR CTGAAGATCTGGAGAGAACA TGG Intronic
901615424 1:10535674-10535696 CTGAAGAATTGAAGAGAATAGGG + Intronic
902704154 1:18192942-18192964 CTGAGGATCTGGGGTGAATAAGG + Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
903835730 1:26202236-26202258 CTGAACTCCTGGAGAGAAAAAGG + Intronic
903872452 1:26446256-26446278 CTGCTGAGCTGGAGAGAGCAAGG - Intronic
904351103 1:29907273-29907295 CTGAAGCTCCAGAGAGGACAGGG - Intergenic
904370920 1:30046907-30046929 CTGCAGTTCAGGAGAGAACACGG + Intergenic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
905145071 1:35882042-35882064 CTGAATAGATGGAAAGAACAAGG + Intronic
907809023 1:57850122-57850144 CTGAAGAGAAGGAGAGAACCAGG + Intronic
907870429 1:58437987-58438009 CTGCACATATGGAGGGAACATGG - Intronic
908273660 1:62446658-62446680 CTGTAGATCTGGACAAAACTAGG - Intronic
908694951 1:66829110-66829132 AAGAAGCTCTGGAGAGAAGATGG + Intronic
909294350 1:73927903-73927925 GTGGTGGTCTGGAGAGAACAAGG - Intergenic
909868566 1:80707428-80707450 CTGAGAATCTGGAAAGGACAAGG + Intergenic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910665773 1:89724823-89724845 GTGAAAATGTGGAGAGACCAGGG + Intronic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
913219385 1:116647149-116647171 CTGAAGGTCAGGAGAGACCCAGG + Intronic
913456494 1:119037012-119037034 CTGAAAATATGAAGAGAATAAGG - Intronic
917112483 1:171563171-171563193 CTACAGATGTGGAGAGAAAATGG - Intronic
917538257 1:175890110-175890132 CTGAAGACCTGGAAAGTACCAGG - Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
919784555 1:201251007-201251029 GAGAACATCTGGTGAGAACAGGG + Intergenic
920187570 1:204170592-204170614 CTAAATACCTGGAAAGAACAAGG + Intergenic
920328939 1:205190759-205190781 GTGAAAATCTGGGGAGGACAGGG - Intronic
921728754 1:218553356-218553378 CTGAACATCTGGAGGAAATATGG - Intergenic
922669906 1:227501762-227501784 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
922894041 1:229087265-229087287 CTTAAGATCTGGAGTGAAGTGGG + Intergenic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
923332374 1:232936997-232937019 CTGAAGTTCTGAAGAAAGCAAGG - Intergenic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1063317551 10:5021110-5021132 CTGAGGCTACGGAGAGAACAGGG - Intronic
1063878417 10:10505905-10505927 CTTGAGATCTGAAGATAACATGG - Intergenic
1065236150 10:23654621-23654643 GGGAAGATGTGGAGAGAATACGG + Intergenic
1065380317 10:25083653-25083675 CTGAGGTTCCAGAGAGAACAGGG - Intergenic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1068197826 10:53741485-53741507 CTGAATAGCTGCAGAGAAAAAGG + Intergenic
1069918239 10:71800265-71800287 CAGAAGATGTGGACAGAGCAGGG - Intronic
1069995228 10:72337735-72337757 CTGAGGCTGTGGAAAGAACAGGG - Intronic
1070588775 10:77786815-77786837 CTGAAGCTCCAGAAAGAACAGGG + Intergenic
1071098660 10:82009996-82010018 CTGGAGAAGTGGAGATAACAAGG + Intronic
1072051304 10:91706282-91706304 TTGAATATCTGGAGAGACCAAGG - Intergenic
1072214613 10:93277494-93277516 CTGCACATCTGGAGACACCAAGG + Intergenic
1072771339 10:98141771-98141793 GTGAACATCTAGAGAGAACCAGG + Intronic
1073622987 10:105068025-105068047 CTGAAATTCTGGAGAGAGTAGGG - Intronic
1073716646 10:106115134-106115156 CTGCTGATCTGTAGAGACCATGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075476679 10:122741397-122741419 CTGTAGAGCAGGAGAGAATAGGG + Intergenic
1075803670 10:125169840-125169862 CTGCAGAGCTGAAGAGCACAGGG - Intergenic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1077134081 11:990140-990162 CTGCAGACCTGCAGAGAGCAGGG + Intronic
1078159906 11:8831449-8831471 GAGAAGATCTGGAGAGACGATGG - Intronic
1078519323 11:12050814-12050836 CTGCAGAGCTGGAGGGAACTGGG + Intergenic
1080587639 11:33696003-33696025 CAGAAGAGCAGGAGAGAAGAGGG - Intergenic
1082771651 11:57212392-57212414 CTGAAGGTTTGTAGAGAAAATGG - Intergenic
1082841338 11:57692673-57692695 CTGGAGAACTGCAGAGAACACGG - Exonic
1082887989 11:58108669-58108691 ATGAAGACCTGGAGAAAAGATGG + Intronic
1083763644 11:64832120-64832142 CTTCAGAACTGGAGAGAGCAAGG + Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1087837662 11:102891027-102891049 GTTAAGATCTGGAGAGATCAAGG - Intergenic
1089196400 11:116696199-116696221 CTGAAGGTCTGGAGAGGGTAAGG - Intergenic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1090201502 11:124861189-124861211 CTGGAAATCTGGAGACAACTGGG - Intergenic
1090285890 11:125498607-125498629 CTGAAGATCTAGACAAAAGATGG - Exonic
1090648540 11:128786597-128786619 CTGGAGGACGGGAGAGAACAAGG - Intronic
1090870392 11:130739703-130739725 CTGAAGACATGAGGAGAACAAGG + Intergenic
1091352067 11:134905804-134905826 ATGAAGATTTGGGGTGAACAAGG - Intergenic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1094814740 12:34171658-34171680 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1095102192 12:38196924-38196946 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1095535758 12:43245023-43245045 CTGAAGATGTGGGGAGATGATGG + Intergenic
1096882358 12:54683390-54683412 CAGAATAGCTGCAGAGAACAAGG - Intergenic
1097379830 12:58881286-58881308 CTCATTATCTGGGGAGAACATGG - Intronic
1097915511 12:65016902-65016924 CTGAAGAAATGGAAAAAACATGG + Intergenic
1098529546 12:71526122-71526144 CTGATGATCTAGAGAGAATAAGG + Intronic
1098583185 12:72125914-72125936 CTGAGAATCTGGGGAGACCAAGG + Intronic
1098977274 12:76915829-76915851 CTGAAGGCTTGGAGAGAACTTGG + Intergenic
1101133649 12:101715831-101715853 AGGAAAATCAGGAGAGAACATGG + Intronic
1102568110 12:113810333-113810355 CTGAAGATCTGCGGAAAAGAAGG + Intergenic
1102767168 12:115443500-115443522 CTGCAGATCTGTAGATAACATGG - Intergenic
1102792023 12:115654742-115654764 CTAAAGAGATGGAGAGAATAAGG + Intergenic
1102857001 12:116302708-116302730 CTGAAGAACTAGAGAGAGCCAGG + Intergenic
1102899058 12:116621981-116622003 CTGAAGATCAGGTGAGGACTTGG - Intergenic
1104099768 12:125596128-125596150 CTGAGTATCTGGGGAGAACATGG - Intronic
1104393583 12:128412287-128412309 CTGAAGATGGGGAGAAAAGATGG - Intronic
1104667711 12:130659073-130659095 CTGAAGATCTGTATATGACAAGG + Intronic
1104930823 12:132338603-132338625 CCTCGGATCTGGAGAGAACAGGG + Intergenic
1106223006 13:27762485-27762507 CTGAAAATCTGGGGAGACCAAGG + Intergenic
1107042484 13:35964171-35964193 CAGAAGTTCTGCAGAGAAAATGG - Intronic
1107052222 13:36063335-36063357 CTGAAGAGCCAGAGAGAACGTGG + Intronic
1107080347 13:36367670-36367692 CAGAAGATCTGAAGTAAACAGGG + Intronic
1108362677 13:49681844-49681866 ATGAAGACCTAGAGAAAACATGG + Intronic
1108496269 13:51028316-51028338 ATGAAGAAGTGGAGAGGACAGGG - Intergenic
1109030571 13:57183283-57183305 CTTAAGAACTGTAGAGAAAAGGG + Intergenic
1109765806 13:66895500-66895522 TTGAACATTTGCAGAGAACATGG - Intronic
1111053452 13:82916659-82916681 CTGAAGATCTTGAGAATCCAAGG + Intergenic
1112150285 13:96752443-96752465 ATGAAGTTTTGGAGAGAATATGG - Intronic
1112169184 13:96951939-96951961 CTGAAGATATATAAAGAACATGG + Intergenic
1112212182 13:97388720-97388742 CTGGAGATATAGACAGAACAGGG - Intronic
1112534026 13:100232127-100232149 CATAAGATCTGGCCAGAACAGGG + Intronic
1113252253 13:108466721-108466743 CTGAAGGTTTGGCGAGAAGAAGG + Intergenic
1113317891 13:109203555-109203577 CTGAGGATTAGGAGAGAACCAGG - Intronic
1114204777 14:20558643-20558665 ATCTTGATCTGGAGAGAACATGG + Exonic
1115738068 14:36356262-36356284 CTGAAGATCAGGAGAGATTGTGG + Intergenic
1117845142 14:59903856-59903878 CTGTAAATCTGTAGAGAAAAGGG + Intergenic
1117889362 14:60401565-60401587 CAGATGATCTGGACAGAACAAGG - Intronic
1117916976 14:60687998-60688020 CTAAAGAACTGGAGAGACCCTGG + Intergenic
1118865076 14:69696582-69696604 CTGAAGATGTGGAAAGAAGGAGG - Intronic
1120266296 14:82254746-82254768 CTGAAGGTCTGGGAAGAACTTGG - Intergenic
1120563029 14:86019701-86019723 CTGAGGGTCTGGCTAGAACAGGG - Intergenic
1120651034 14:87133201-87133223 ATGAAAATCTGAAAAGAACAAGG + Intergenic
1121017140 14:90555764-90555786 CTTCAGCTCTGGAGAGACCAAGG + Intronic
1121379883 14:93455337-93455359 ATGGAGATGTGGAGAGAACAAGG - Intronic
1121448935 14:93995763-93995785 CTGAAAATCCAGAGAGGACAGGG - Intergenic
1121833601 14:97072615-97072637 CTGCTGATCTGGAAAGAAAATGG - Intergenic
1122638525 14:103142567-103142589 CTGAGGATCTGGCGATAAGATGG - Intergenic
1123156971 14:106236088-106236110 CTGAAAATATGGAGAGAACTAGG + Intergenic
1123188052 14:106538846-106538868 CTGAAAATATGGAGAGAACTAGG + Intergenic
1123189810 14:106557979-106558001 CTAAAGATATGGTGAGAACTAGG + Intergenic
1124234916 15:27981830-27981852 CTGAAAGTCTGGGGAGACCAGGG - Intronic
1124586531 15:31014830-31014852 CTGAGGAACTGGAGATATCAGGG - Intronic
1124838233 15:33216171-33216193 CTCCAGGTCTGGAGAGAGCAGGG + Intergenic
1125089290 15:35771751-35771773 ATGACGGTCTGGGGAGAACAGGG - Intergenic
1126304491 15:47239559-47239581 ATGAAGATCTGGAAAGAATATGG + Intronic
1126475529 15:49061959-49061981 CTGAAAATCTGGAGACCCCATGG - Intergenic
1128347259 15:66862322-66862344 CTGAAGAACTGTGGGGAACAGGG + Intergenic
1128767946 15:70262473-70262495 CTGGAGAGCTGGAGAGAGCCAGG + Intergenic
1128830527 15:70763811-70763833 CTTAAGATCTAGAGAGAGCACGG + Intergenic
1129170854 15:73807008-73807030 CTGAACCACTGGAGAGACCATGG - Intergenic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1129925458 15:79359680-79359702 CTGAAGAGATTGAGAGATCAAGG + Intronic
1130700040 15:86169165-86169187 CTGAAGGCCTGGAGAAACCAAGG + Intronic
1132070206 15:98769999-98770021 CAGGAGATCTACAGAGAACAAGG - Intronic
1135752844 16:25070725-25070747 CTGAAGGACTGCAGAAAACATGG - Intergenic
1135788767 16:25374533-25374555 GTGAAGATCTGGTGGGAATAAGG + Intergenic
1135962679 16:27010829-27010851 CTGAAGACCTGGACATCACAAGG - Intergenic
1136531934 16:30875608-30875630 CTTAAGATCTGGTGAGGGCACGG - Intronic
1136869927 16:33797643-33797665 CTGAAAATATGGAGAGAACTAGG - Intergenic
1137849972 16:51731865-51731887 CTGAATTTCTGGAGCGGACAGGG + Intergenic
1138239846 16:55418652-55418674 CAGAAAGTCAGGAGAGAACATGG - Intronic
1138712583 16:58986355-58986377 CTCAGGCTCTGGAGAGCACATGG - Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1203102245 16_KI270728v1_random:1318412-1318434 CTGAAAATATGGAGAGAACTAGG + Intergenic
1143727708 17:8860771-8860793 CTGAAGCCCTGGGGAGCACATGG - Intronic
1145917434 17:28583592-28583614 AGCAAGATCTGGAGAAAACACGG - Exonic
1149144074 17:53468769-53468791 TTGAAGATCTGGAGAGGGGAGGG + Intergenic
1149283988 17:55141403-55141425 CTTCACATCTGGAGAGAACCTGG + Intronic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150972310 17:70042724-70042746 CTGAAGATATGGAGAAAAAGGGG - Intergenic
1152281619 17:79388273-79388295 CAGAAGAGCTTGAGAGAACAAGG + Intronic
1157083727 18:44555640-44555662 CTGAGGATTTGGCTAGAACATGG - Intergenic
1157953171 18:52063838-52063860 GGGCATATCTGGAGAGAACAGGG - Intergenic
1158224730 18:55189166-55189188 GTGAAGATTTGAATAGAACAAGG - Intergenic
1159611063 18:70526182-70526204 CTGAACCACTGGAGAGAAGACGG + Intergenic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1162869903 19:13578284-13578306 CTTAAGATGTGGATAGATCAAGG - Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166794333 19:45417311-45417333 CTGATGATCTGGAGTGGCCAGGG + Intronic
1166993002 19:46704483-46704505 CTGAAGAGCTGGTGAGGAGATGG - Exonic
1168241186 19:55089665-55089687 CTGAGGAGCTGGAGAAAGCAGGG - Intergenic
1168361593 19:55745379-55745401 CTGAAGGTCTGGAGTGCATAAGG - Intergenic
927815500 2:26212873-26212895 TTGAAGATCAGGAGAGAAGCCGG - Intronic
928180963 2:29068055-29068077 CAGAAGAGCTTGAGAGAACAGGG - Intronic
928603622 2:32924504-32924526 CTGAGGATCCGGAGAGTAGAGGG + Intergenic
928653415 2:33425275-33425297 CTTCAGATCTGGGGATAACAAGG - Intergenic
928782677 2:34844061-34844083 CTCAAGTGCTGGAGAGAACTAGG + Intergenic
930317760 2:49818054-49818076 CTGAAGATGAGGAGAAAAAAAGG + Intergenic
930413912 2:51065090-51065112 CTGAAGATCTGCCAAGCACATGG - Intergenic
930766864 2:55093600-55093622 CCTGAGATCTGGAGAGTACAAGG + Intronic
930851086 2:55961290-55961312 CTGTAGATCTGGAAAGAAGTTGG + Intergenic
931218058 2:60264445-60264467 TGGAAGCTCTGGAGAGAGCAGGG - Intergenic
931562812 2:63581273-63581295 CTGAAAAACTGGAGAAGACAAGG + Intronic
931827335 2:66015298-66015320 CTGAAGATCTGTAGCGATAATGG - Intergenic
932267219 2:70378116-70378138 GTGTAGATCTGGAGACAGCATGG + Intergenic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
932856656 2:75241244-75241266 CACCAGATCAGGAGAGAACAGGG + Intergenic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933450645 2:82445806-82445828 CTGATTATCTGGTGAGGACAAGG + Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
936265897 2:111006396-111006418 CTGACGATCTGGGGAGACCTAGG + Intronic
936949068 2:117958980-117959002 CTGATGTTCTGGAGTTAACAGGG + Intronic
937111696 2:119371562-119371584 CTGAAGCACTGGAGAGTACATGG - Intronic
938246208 2:129779799-129779821 CTTCAGATCTGGAGAGACCAAGG - Intergenic
938645713 2:133328015-133328037 CTGAAGATGTGGAGAGTATTTGG - Intronic
938946225 2:136214411-136214433 CTGAAGAGGGGAAGAGAACAGGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940993975 2:160127208-160127230 AAGAAGATCTGGAAAGAAAAGGG - Intronic
943728802 2:191280223-191280245 CTGAAGCTCTGGATAGAGCAAGG + Intronic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
946028523 2:216687327-216687349 CTGAAGATATATAGAGAAAAGGG + Intronic
946482294 2:220068845-220068867 CTGTAAGTCTGGGGAGAACAGGG - Intergenic
946531232 2:220572483-220572505 CTGGAGATGTGGACAGAACAAGG + Intergenic
946591967 2:221259933-221259955 GTGGAGCTCTGGAGAGAGCATGG + Intergenic
947314933 2:228846618-228846640 CAGAAGATTTGGAGAAAAGAGGG - Intergenic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1170010096 20:11713349-11713371 CTGAAGGTTTTGAGAGAAAAGGG + Intergenic
1171116771 20:22531565-22531587 CTGAAGCTCTGAAAGGAACATGG + Intergenic
1171776510 20:29373174-29373196 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171817785 20:29803680-29803702 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171900452 20:30851591-30851613 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1172230747 20:33334037-33334059 CTGAAGATCTGATGGGAAGATGG - Intergenic
1172617237 20:36297467-36297489 CTGAAGGTGTGGAGTGAGCAAGG - Intergenic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1175180421 20:57142753-57142775 CTGAAGAACTGGGGACAGCAGGG + Intergenic
1177544227 21:22535448-22535470 TTGACTATCTGGACAGAACAGGG + Intergenic
1178433561 21:32537318-32537340 CAGAAGATCATGAGAGAAGATGG + Intergenic
1180321233 22:11323169-11323191 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1180333810 22:11557576-11557598 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1180820676 22:18825204-18825226 CTGAAGCTCAGGAGAGACCCAGG + Intergenic
1181192297 22:21150843-21150865 CTGAAGCTCAGGAGAGACCCAGG - Intergenic
1181206899 22:21259676-21259698 CTGAAGCTCAGGAGAGACCCAGG + Intergenic
1181928706 22:26381467-26381489 CTGAGGAGGTGCAGAGAACAGGG + Intronic
1182357186 22:29727520-29727542 CTGCAGATCTGGTGAGAGCATGG - Intronic
1183931255 22:41237437-41237459 CTGGGGACCTGGGGAGAACACGG - Exonic
1184683818 22:46086964-46086986 CTGAAGATCTGAAGATAAACAGG - Intronic
1185225294 22:49648516-49648538 CTGCAGATCTGGAGAGGATCAGG - Intronic
1203220024 22_KI270731v1_random:35747-35769 CTGAAGCTCAGGAGAGACCCAGG - Intergenic
1203270802 22_KI270734v1_random:51079-51101 CTGAAGCTCAGGAGAGACCCAGG + Intergenic
949559755 3:5189897-5189919 CTTAAAATCTGGAAAGACCATGG - Intronic
949920281 3:8994622-8994644 CTGCACAGCTGGTGAGAACATGG + Intronic
950006517 3:9695022-9695044 CTACAGGACTGGAGAGAACATGG - Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
951476455 3:23111625-23111647 CTGAAGAGATGGAAAGAACTTGG + Intergenic
953367007 3:42353623-42353645 CAGAAGTTCCTGAGAGAACAGGG + Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
957088576 3:75706479-75706501 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
957246652 3:77724245-77724267 CAGAAGTTCAGGAAAGAACAAGG - Intergenic
957807333 3:85166332-85166354 CTGAAAATTTGGATATAACATGG + Intronic
959226196 3:103588670-103588692 CTGAAGATCTGTGGACCACATGG - Intergenic
960555839 3:119029502-119029524 CTGAATAACTGGAAAGAACCAGG + Intronic
960844381 3:121993293-121993315 CTGGAGCTCTGAAGAGGACAAGG - Exonic
961153452 3:124659062-124659084 CTGAAGTGGTGGAGAGAATAAGG + Intronic
962599952 3:136984197-136984219 CTGAAGATAAAGAGAGGACAAGG + Intronic
963044781 3:141094570-141094592 ATGACGACCTGAAGAGAACATGG + Intronic
966679433 3:182625842-182625864 ATGAAGATTGGCAGAGAACAAGG + Intergenic
968049428 3:195644030-195644052 CTGAAGACCTGGAGAGGAGGTGG + Intergenic
968097975 3:195945596-195945618 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968106441 3:196004979-196005001 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968305190 3:197645902-197645924 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968357315 3:198119602-198119624 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
968876546 4:3270644-3270666 CTGGAAAACTGGACAGAACATGG - Intronic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
972830683 4:42810393-42810415 CTGAAGATCTGCAGAGTCCAGGG + Intergenic
974053566 4:56963421-56963443 GTTAATATCTGGAGTGAACAAGG + Exonic
974445017 4:61968981-61969003 CCGAAGAGCTAGAGGGAACATGG + Intronic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
976488709 4:85641518-85641540 ATGAAGACCCGGAGAGAAGATGG - Intronic
977143724 4:93409046-93409068 TAAAAGATGTGGAGAGAACAAGG - Intronic
977910689 4:102532276-102532298 CTAGAGAACTGGAGAAAACAAGG - Intronic
978340740 4:107719710-107719732 CTGAAGATGTGCAGAGAAGGCGG - Intronic
978956904 4:114625099-114625121 ATGATGACCTAGAGAGAACAAGG - Intronic
980315904 4:131199961-131199983 CTTAATATTTTGAGAGAACAAGG - Intergenic
980332380 4:131426453-131426475 CTGGAGCTCTGGAGAGCTCAAGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
983203167 4:164884288-164884310 TTGAAGAGATGAAGAGAACATGG - Intronic
985442071 4:189989244-189989266 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
985506092 5:281294-281316 CTGAAGACCTGGAGAGGAGCTGG + Intronic
985885617 5:2675437-2675459 CTGATACTCTGGAGGGAACATGG - Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986253496 5:6082435-6082457 GAGAAGGTCTGAAGAGAACAGGG - Intergenic
986630406 5:9767047-9767069 CTGAAGCTCTGGAGAGGCCATGG - Intergenic
988305629 5:29490577-29490599 AAGAAAATCAGGAGAGAACAGGG - Intergenic
988417337 5:30961836-30961858 CTGAAGATATGGATAATACATGG + Intergenic
989519274 5:42381931-42381953 GTGAAGATCTTAAGAGACCATGG - Intergenic
990322380 5:54642564-54642586 CTAAAGACCTGGAAGGAACAAGG - Intergenic
991247982 5:64528144-64528166 CCGAAGATCTAGGGAGAAGACGG + Intronic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993637190 5:90358883-90358905 GTGTAGATCTGGAGAGATTAGGG + Intergenic
993800228 5:92324294-92324316 CTGATGATCTGGAGAACACAAGG - Intergenic
995020316 5:107360007-107360029 CTGAATATCTGGTGATAAGAAGG + Intergenic
996682207 5:126239736-126239758 CTGAACATCTGGGCAGATCAAGG - Intergenic
996814434 5:127559189-127559211 CTGAAAAGCAGGAGAGAAAAAGG - Intergenic
996841197 5:127849292-127849314 CTGTAGAACTGGGGAGAATAAGG - Intergenic
997534584 5:134608838-134608860 CTGAAGCTCTAGAGAGAATTAGG + Intronic
997570286 5:134922083-134922105 CTGAAGAAGTGGGGAAAACAAGG + Intronic
998504449 5:142660666-142660688 CTGATGAGCTGAGGAGAACACGG - Intronic
999194916 5:149775236-149775258 CTGTGGATCTGGAGAGGGCAGGG + Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999335845 5:150715852-150715874 ATGAGGAACTGGGGAGAACATGG + Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999630944 5:153570883-153570905 CTGAATATCTATAGTGAACAAGG - Intronic
999832756 5:155336514-155336536 CTGGAGAGCTGGAGAAATCATGG - Intergenic
999924937 5:156364834-156364856 CTACAGTTCTGGAGAGAAAATGG - Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1002403499 5:179009220-179009242 CTGAGAATCTGGAGAGCCCATGG + Intergenic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003509230 6:6765550-6765572 CAGGAGATCTGGAGGGAACAAGG + Intergenic
1004442594 6:15668207-15668229 CTGAAGAACAGGAGAGAAGGGGG + Intergenic
1004963184 6:20815970-20815992 CTATAGCTCTGGAGAGAACATGG - Intronic
1005992289 6:30910830-30910852 CTGAAGAACAGAAGAGAACAGGG - Intronic
1006080069 6:31559970-31559992 CTGAAGTTCGGAAGAGACCAAGG + Intergenic
1006690174 6:35876898-35876920 CTGAGAGTCTGGAGAGACCAAGG + Intronic
1006856006 6:37133779-37133801 CTGAATCTGAGGAGAGAACATGG + Intergenic
1010454495 6:76039258-76039280 CTGTTGATCTGCAGACAACATGG + Intronic
1010528056 6:76927558-76927580 TTGGAGAACTGGAGAGACCAAGG + Intergenic
1010655813 6:78509334-78509356 CTGAAGTTCTCGGGAGAACTAGG + Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011270756 6:85577547-85577569 CTCAATCTCTGGAGAGAATATGG + Intronic
1011542597 6:88448222-88448244 GTGAAGATGTGGAGAGAAATTGG + Intergenic
1012464734 6:99504536-99504558 CAGAGGATCTGGAGAGAAATGGG + Intronic
1013184970 6:107749633-107749655 GTGATGGTCTGTAGAGAACAGGG - Intronic
1014192380 6:118512235-118512257 CTGAGAATCTGGAGAAACCAAGG + Intronic
1014338396 6:120169718-120169740 ATGAGGATCAGGGGAGAACAAGG - Intergenic
1015911611 6:138173637-138173659 TAGAAGAGCTGGAGAGAATATGG + Intronic
1017757767 6:157544108-157544130 ATGAGGAGCTGGAAAGAACAAGG - Intronic
1017932416 6:158969576-158969598 CAGAATATCTGAAGAGATCATGG - Intergenic
1018729636 6:166639002-166639024 GTGACGACCTGGTGAGAACAGGG - Intronic
1019117349 6:169775631-169775653 CTGAAGCTCAGGAGAGAAGTAGG + Intronic
1019291863 7:254401-254423 CTGTAGAACTGGTGAGAACGTGG - Intronic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1021250651 7:18321257-18321279 CTGAAGGTCTGGAGTTAACCAGG - Intronic
1021355600 7:19650691-19650713 CTGAGGCTCTGGAGTGAGCATGG + Intergenic
1022880997 7:34587256-34587278 CTGTTGATCTGAAGGGAACATGG - Intergenic
1022959901 7:35416440-35416462 CTGAAGAGCTACAGAGGACATGG + Intergenic
1023542616 7:41282615-41282637 CTGAGTATCTCGAGGGAACAAGG + Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024667993 7:51564954-51564976 CTGAAGAAACGGAGAGTACAGGG - Intergenic
1028025717 7:85836108-85836130 ATGAAGATCTTGAGAGAAATTGG - Intergenic
1028712618 7:93926984-93927006 CCCAAGACCTGGAGAGCACATGG - Exonic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1029991210 7:104964144-104964166 CTGAAGGTCTGTAAGGAACATGG - Intergenic
1030643344 7:112030965-112030987 CTGCAAATCACGAGAGAACATGG - Intronic
1031142234 7:117956122-117956144 CTGAAGATTTGGAGATACCCAGG - Intergenic
1031362283 7:120860887-120860909 CTAAAGTTGTGGAGAGAAAAAGG + Intergenic
1031372169 7:120981705-120981727 GTGAAGATGCAGAGAGAACAGGG - Intergenic
1032345331 7:131110846-131110868 CTGAAGATGAGGAGAGAAGCGGG - Intronic
1034323577 7:150208226-150208248 CTGAGAGTCTGGGGAGAACAAGG + Intergenic
1034683841 7:152952305-152952327 GTGCAGAACTGGACAGAACAAGG - Intergenic
1034703099 7:153113854-153113876 CTGAAAATCTGGGGAGCAAAGGG - Intergenic
1034769617 7:153760961-153760983 CTGAGAGTCTGGGGAGAACAAGG - Intergenic
1035345681 7:158196289-158196311 CTGAAGGTCTGGGGAAACCAAGG - Intronic
1035928922 8:3759993-3760015 CTGGACATCAGGAGAGAAAATGG - Intronic
1036471025 8:9052940-9052962 CTCAACCTCTGGAGAGAAGAGGG + Intronic
1037613175 8:20493737-20493759 CTAAAGCTCTAGAGAAAACAAGG - Intergenic
1037911816 8:22748169-22748191 CCCCAGATCTGGAGAGAAAAGGG + Intronic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038904371 8:31882068-31882090 TTGAATAGCTGGAGAGAATAAGG + Intronic
1039101160 8:33943408-33943430 CTGAAGAGCTGGAAAGACAAGGG - Intergenic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1041522377 8:58770722-58770744 CAGAACATGTGGAAAGAACAGGG - Intergenic
1041629938 8:60075890-60075912 CTATAAATCTGGAGATAACAAGG - Intergenic
1041919946 8:63169554-63169576 CCGAAGTTCTGGATAGAACTTGG - Intronic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1051944227 9:22547064-22547086 GTGAAGATGTGGAGAGGAGATGG - Intergenic
1052351220 9:27460307-27460329 CAGAAAATATGGAGAGCACATGG - Intronic
1053649986 9:40157741-40157763 CTCAAGATCTGGTGAAAAAATGG + Intergenic
1053755754 9:41306186-41306208 CTCAAGATCTGGTGAAAAAACGG - Intergenic
1054330494 9:63749499-63749521 CTCAAGATCTGGTGAAAAAATGG + Intergenic
1054534595 9:66218462-66218484 CTCAAGATCTGGTGAAAAAATGG - Intergenic
1054879231 9:70127577-70127599 ATGTAGAGCTGCAGAGAACAGGG + Intronic
1056765992 9:89444939-89444961 CTGAACATCCCGACAGAACAGGG + Intronic
1057784014 9:98073242-98073264 GTGATGAGCTGGGGAGAACAGGG - Intronic
1059829915 9:118083812-118083834 ATGAAGATGTTGAGTGAACAGGG + Intergenic
1060148982 9:121275213-121275235 CCGAAGAAGTGGAGAGAACTTGG + Intronic
1060852552 9:126889606-126889628 CTGAATATCTGGAGAGGGAAGGG - Intergenic
1061516259 9:131092267-131092289 CAGCAGATCTGCAGAGATCAAGG + Exonic
1202797875 9_KI270719v1_random:142417-142439 CTCAAGATCTGGTGAAAAAACGG + Intergenic
1203369445 Un_KI270442v1:288942-288964 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1185887259 X:3793780-3793802 CAGAAGATTTGGATAGAACCAGG + Intergenic
1189201476 X:39199619-39199641 CTTAAGATCTGTTGAGAACTAGG + Intergenic
1189635173 X:42999996-43000018 CTGAAGGGCAGGAGTGAACATGG + Intergenic
1190832484 X:54071615-54071637 ATGAAGGTTTGGAGAGAAAAGGG - Exonic
1192622133 X:72688563-72688585 TTCAAGATCTGGAGAGAAGAAGG - Intronic
1193442025 X:81553733-81553755 CTGATGATCTGGATAAGACAAGG - Intergenic
1194784807 X:98069644-98069666 GAGAAGATCTAGAGTGAACAGGG + Intergenic
1196458243 X:115904804-115904826 GTGAAGTTCTGGAGACAAAAAGG - Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199594080 X:149493110-149493132 CTGAAAATCAGGAGAGACCTGGG + Intronic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1199900736 X:152169577-152169599 CTGAAGAACAGGAGAGGCCAGGG + Intronic
1200163852 X:154022787-154022809 CTGAAGAGCTGGGGAGAATGGGG - Intronic
1201068834 Y:10126018-10126040 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1201318741 Y:12674035-12674057 CTAAAGAACTGGTAAGAACAAGG - Intergenic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic
1202193622 Y:22272526-22272548 CTGAAGATCCAGAGGGCACATGG + Intergenic