ID: 975425601

View in Genome Browser
Species Human (GRCh38)
Location 4:74223399-74223421
Sequence AAGTAGGAGCTAAATGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 2, 2: 5, 3: 29, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975425598_975425601 2 Left 975425598 4:74223374-74223396 CCAAATACTGCATGCTCTCACTT 0: 52
1: 1320
2: 3229
3: 10252
4: 16918
Right 975425601 4:74223399-74223421 AAGTAGGAGCTAAATGATGAGGG 0: 1
1: 2
2: 5
3: 29
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975425601 Original CRISPR AAGTAGGAGCTAAATGATGA GGG Intronic
900723717 1:4200124-4200146 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
902302882 1:15515067-15515089 TAGTAGGAGCTTAATTCTGAAGG - Intronic
904905214 1:33892529-33892551 AAGTGGGAGCTAAGCTATGAGGG - Intronic
906070770 1:43014876-43014898 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
906175778 1:43771101-43771123 AAGAAGGGGATAACTGATGAGGG - Intronic
906831593 1:49037484-49037506 AAGTAGAAGCCAAGTGAGGAGGG - Intronic
908033707 1:60029489-60029511 AAGTAGGAGCCAGTTTATGAAGG - Intronic
908310982 1:62883266-62883288 AATTAGGAGCTAAATCTAGATGG - Intergenic
909345955 1:74587596-74587618 AAGTAGGATATACATAATGAGGG - Intronic
909689127 1:78386749-78386771 AAGTATTTGCTAAATGATGAAGG - Intronic
909760139 1:79276229-79276251 AAGTGGGAGCGAAATGATGATGG + Intergenic
910233637 1:85012030-85012052 AAGTGGGAGCTAAGCTATGAGGG + Intronic
911559228 1:99383611-99383633 AAGTGTGAGCTAAATATTGAAGG + Intergenic
913435606 1:118844538-118844560 ATGAAGGAGCTAAATGATGATGG - Intergenic
916226158 1:162491449-162491471 AAGTAGGTGCTTAATGATACAGG - Intergenic
916253429 1:162761480-162761502 AAGTGGGAGCAAGGTGATGAAGG + Intronic
916282004 1:163061950-163061972 TACTAAGACCTAAATGATGAAGG - Intergenic
916869679 1:168899836-168899858 AAGTAGGTGCTAACAGATGGTGG + Intergenic
916944515 1:169712365-169712387 AATTAGGACCCATATGATGAAGG + Intronic
918135463 1:181669975-181669997 ATGTAGGAGATAAATTATCATGG - Intronic
918950624 1:191132005-191132027 AAGTGGGAGCTAAATATTGAGGG + Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
919970053 1:202570071-202570093 GAGTAGGTGCTAAGTGATTATGG - Intronic
920702651 1:208229569-208229591 AAGAAGGAGGTAAATGATTTAGG + Intronic
923556777 1:235007276-235007298 AAGCAGGAGGCACATGATGATGG + Intergenic
923617641 1:235551030-235551052 GAGTAGGAGCCAAAAGAGGAGGG + Exonic
1063035357 10:2281482-2281504 ATGTAAGAGATCAATGATGAGGG - Intergenic
1065239083 10:23687224-23687246 AAGGAGGAGTTTAATGATGCTGG - Intergenic
1067233659 10:44428561-44428583 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1067259821 10:44679671-44679693 AAGTGGGAGCGAAAAAATGAGGG - Intergenic
1067730495 10:48807066-48807088 GATTAGGAGCTAATTGAAGATGG + Intronic
1067995606 10:51269647-51269669 AAGTGGAAGCTAAACTATGAGGG + Intronic
1068226639 10:54115077-54115099 AAGTAGGAGGTAGGTGATGGTGG + Intronic
1069107399 10:64399793-64399815 AAGTGGGAGCTAAACTATGAGGG - Intergenic
1070020139 10:72577116-72577138 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1070622854 10:78027312-78027334 ATGCAGGAGCTAAAGCATGAGGG + Intronic
1071079078 10:81788585-81788607 AGATAGAAGCTAAATGAAGAGGG - Intergenic
1071379327 10:85042375-85042397 AGGTGGGAGCTAAAGGAGGAGGG + Intergenic
1071797534 10:89022447-89022469 AAGAAGTAGATAAATGAAGAGGG - Intergenic
1073364383 10:102926335-102926357 AAGTAGGAGCTGGATGAAGCGGG + Intronic
1073742088 10:106419082-106419104 AAGTAGGAGCTAAGCTATGAAGG + Intergenic
1074239285 10:111621308-111621330 AATGAGGAGCTAAATGTTGGTGG + Intergenic
1075494275 10:122906291-122906313 AAGTGGGAGCTAAGCCATGAGGG + Intergenic
1075526580 10:123192048-123192070 AAATGGGAGTTAAATGCTGAGGG + Intergenic
1077784313 11:5366179-5366201 AAGTAGGAAGTTAAGGATGAGGG + Intronic
1078000109 11:7487033-7487055 AAGTCGGTGCTAAATGCAGAGGG - Intronic
1079180839 11:18192183-18192205 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1079405374 11:20140593-20140615 AAGTAGGAGCTGTGTGTTGAGGG + Intergenic
1079482520 11:20896192-20896214 AAGTGGGAGCTAAGCTATGAGGG - Intronic
1080198138 11:29635783-29635805 AGGTTGGTGCTAAATGATTATGG + Intergenic
1085948891 11:81305702-81305724 ATGTAAGAGCTAGATGATGGAGG - Intergenic
1086316694 11:85602306-85602328 ATGTAGGGGATAGATGATGATGG - Intronic
1086857494 11:91883030-91883052 TCTTAGGAACTAAATGATGATGG - Intergenic
1087457342 11:98403552-98403574 AAGCAGGAGGTAAAAGAGGAAGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088692571 11:112340372-112340394 AAGTAGTGTATAAATGATGATGG + Intergenic
1089572282 11:119418681-119418703 GAGAAGGAGGTAAAGGATGAGGG - Exonic
1090146836 11:124333822-124333844 AAGTGGGAGGTAAATGAGCAAGG - Intergenic
1090856896 11:130617733-130617755 AAGTAGGAACTAACTAATCAGGG + Intergenic
1092158229 12:6298954-6298976 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1093016931 12:14164275-14164297 AAGTGGGAGGAAAATGATGGAGG - Intergenic
1093312137 12:17601968-17601990 GACTAGGAGCTGAAGGATGAAGG + Intergenic
1093757784 12:22871787-22871809 AAGTATGAGGGAAAAGATGATGG - Intergenic
1094406014 12:30116931-30116953 AAGTAGCTCCTAAATGGTGAAGG - Intergenic
1094454265 12:30614625-30614647 AAGTGGGAGTTGAATGATGAGGG - Intergenic
1095503530 12:42867262-42867284 ATGTAGTAGCTAGATTATGAGGG + Intergenic
1097311566 12:58124542-58124564 AAGTGGGAGCTGAACAATGAGGG - Intergenic
1097553553 12:61107412-61107434 AAATAGCAGCTAGATTATGATGG + Intergenic
1099993801 12:89754802-89754824 GAGGAGGAGCTAAAACATGAGGG + Intergenic
1100059652 12:90558682-90558704 AAGTGTGAGCTAAACAATGAAGG - Intergenic
1100085568 12:90905992-90906014 AAGTTGAAGCAAAATGATTAGGG + Intronic
1100683151 12:96952161-96952183 AAGTAAGAGTAAAAGGATGATGG + Exonic
1101337897 12:103812999-103813021 ATGTAGGAACTAAGTGATAAAGG + Intronic
1102577007 12:113862056-113862078 AAGGAGGAGCTGAAAGATCAGGG + Intronic
1102716218 12:114975331-114975353 AAGTATGAGCTCTATGATGAGGG + Intergenic
1106222558 13:27758675-27758697 AAGGGGGAGCTAAACGAAGAAGG - Intergenic
1106843546 13:33712268-33712290 AAGTAGAAGCCAAATGACAAAGG - Intergenic
1109157371 13:58927514-58927536 AACAAAGACCTAAATGATGAGGG - Intergenic
1109288063 13:60435478-60435500 AAGTGGGAGCTAAGGCATGAGGG - Intronic
1109925556 13:69133665-69133687 AAGTAGATGCTAAATAATCAAGG + Intergenic
1110995259 13:82099952-82099974 AAGCAGGAGCTAGGAGATGATGG + Intergenic
1111028401 13:82565288-82565310 AACTTGGAGCTTGATGATGAGGG + Intergenic
1111037126 13:82690494-82690516 AAGAATTAGGTAAATGATGATGG - Intergenic
1112810846 13:103216842-103216864 AAATAGGAGGAGAATGATGAAGG - Intergenic
1112925367 13:104667551-104667573 AAGTAGTAGATAAGTGATAATGG + Intergenic
1114867699 14:26617699-26617721 AAGTGGGAGCTAAACATTGAAGG + Intergenic
1114944672 14:27664794-27664816 AAGTGGGAGGTAAATGATAAAGG - Intergenic
1115740623 14:36383970-36383992 AAGTAGAACCTCAGTGATGATGG - Intergenic
1116428086 14:44814567-44814589 AAGTAGGAGCTTAATAAGGAAGG + Intergenic
1118169722 14:63376753-63376775 AAGTAGGAAGTACATGATGCAGG + Intronic
1118236852 14:64013538-64013560 AAGTGGGAGCTAAACAATGGGGG - Intronic
1118547347 14:66906208-66906230 AAGGAGATGCTAAATCATGATGG - Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120735847 14:88051624-88051646 AAGTGGGAGCTAAACTATGAGGG - Intergenic
1121037722 14:90720179-90720201 AAGTAGGAGCTAACTGGCAAAGG - Intronic
1121854931 14:97259419-97259441 AATTATGAGTTAAATTATGAGGG - Intergenic
1124546796 15:30636311-30636333 GAGTACGAACTAAATAATGAAGG + Intronic
1124780401 15:32626307-32626329 GAGTACGAACTAAATAATGAAGG + Intronic
1125261033 15:37824948-37824970 AAGTAGAAGCTGAGTCATGAGGG - Intergenic
1126305046 15:47246344-47246366 CAGTGGGAGCTAAAGCATGAGGG + Intronic
1126477998 15:49087500-49087522 CAGAAGGAGGTAATTGATGATGG + Intergenic
1126988213 15:54339475-54339497 AAGTGGGAGCTAAGCTATGAGGG - Intronic
1127204043 15:56694141-56694163 AAGTATGAGATGAATGATAATGG + Intronic
1128122167 15:65159093-65159115 AAGTAGAAGCTACATGATCTAGG + Intronic
1129623295 15:77169574-77169596 AGGTAGGAGTAAAATGAAGAGGG + Intronic
1131705024 15:94984464-94984486 AAGTGGGAGCTAAATGACGCAGG + Intergenic
1133501217 16:6368596-6368618 ATGTAAGAGCTAAATAATAAGGG - Intronic
1134566203 16:15253992-15254014 AAATAAGAACAAAATGATGATGG + Intergenic
1134736292 16:16502706-16502728 AAATAAGAACAAAATGATGATGG - Intergenic
1134931225 16:18209460-18209482 AAATAAGAACAAAATGATGATGG + Intergenic
1135223182 16:20631798-20631820 AAGTGGGAGCTAAGCTATGAAGG + Intronic
1135492590 16:22922799-22922821 AAGTGGAATCTATATGATGAAGG + Intergenic
1135868127 16:26123724-26123746 AAGTGGGAGCTAAGCTATGAAGG - Intronic
1136075339 16:27813281-27813303 AAGTGAGAGCTAAATGATGAGGG - Intronic
1136625719 16:31461045-31461067 AAATAGTAGCTGAATGATGGGGG - Intronic
1137256161 16:46777345-46777367 AAATATGAGCTAAATAATAAAGG + Intronic
1137929854 16:52576488-52576510 CAGTAGCAGGCAAATGATGATGG - Intergenic
1138828012 16:60344397-60344419 AAGTAGGTGCCACAGGATGAAGG - Intergenic
1138870001 16:60871115-60871137 ATTTAGGTGATAAATGATGATGG + Intergenic
1139239755 16:65378692-65378714 AAGTGGGAGCTAAGCCATGAGGG - Intergenic
1139244432 16:65427834-65427856 AATTAGGAGCTACATGCTAAGGG - Intergenic
1141714467 16:85718844-85718866 CAGTAGGTGCTGAATGTTGAAGG - Intronic
1142977433 17:3654087-3654109 AAGGAGGAGCCCAGTGATGATGG + Intronic
1143593238 17:7898548-7898570 AAGAAGGAGCTACAGGGTGATGG + Exonic
1148517687 17:48236663-48236685 AAGTTTGAGCTAAATCTTGAAGG + Intronic
1148526164 17:48338048-48338070 AAGAAGGAACTAAGTGAAGAAGG - Intronic
1150055974 17:62016402-62016424 CAGTTGGAGCTATTTGATGAGGG - Intronic
1150497389 17:65618430-65618452 AAATATGAGCTCAATGATGTCGG + Intronic
1150893760 17:69185082-69185104 AAGTGGGAGCTAAGCTATGAAGG + Intronic
1152671781 17:81612318-81612340 AGGCAGGATCTAAGTGATGATGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154227696 18:12522495-12522517 AAGATGTAGCTAACTGATGAAGG + Intronic
1154249176 18:12728782-12728804 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1154381118 18:13850800-13850822 AAGTGGGAGCTAAACAAAGATGG + Intergenic
1154436539 18:14347151-14347173 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1155109886 18:22703840-22703862 AAGAAGGAGGTAAATAAAGAAGG - Intergenic
1156169558 18:34465178-34465200 AAGAAGCATATAAATGATGATGG + Intergenic
1157268016 18:46245813-46245835 AAGTAGTAACTAAATTATCATGG - Intronic
1158375604 18:56859801-56859823 AAGTAGAAGCCATATGAAGAAGG - Intronic
1159096258 18:63905864-63905886 AAATAGGAGCTAAATGAATAGGG - Intronic
1159730312 18:72018208-72018230 AGGTACCAGCTAAATGATGTGGG - Intergenic
1159850731 18:73524338-73524360 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1162611124 19:11754146-11754168 AGGTAGTAGCAAAATAATGAAGG + Intergenic
925541304 2:4970611-4970633 AAGTGGGAGAAAAATGAAGAGGG - Intergenic
925665713 2:6253039-6253061 AAGTAGGAGCTAAGCTATGAGGG - Intergenic
926869244 2:17394316-17394338 AAGTGGGAGCTAAGATATGAGGG + Intergenic
926881997 2:17555962-17555984 AAGCAGGAGCTAAATGAAATGGG + Intronic
928861083 2:35857643-35857665 AAGCAGCAGCTAAATGAGGCGGG - Intergenic
929041135 2:37745883-37745905 TAGTTGGAGCCAATTGATGAAGG + Intergenic
930573854 2:53121918-53121940 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
930597184 2:53403105-53403127 AAGCAGGGGATAGATGATGAGGG - Intergenic
931107331 2:59070819-59070841 AAGTCTGAGCGAAAAGATGAAGG - Intergenic
932378352 2:71258666-71258688 AAGATGGCGCTAAATGATGCTGG - Intergenic
932427493 2:71648778-71648800 AAATAGGAACTAAATCAAGATGG + Intronic
932798402 2:74717566-74717588 GAGTAGGAGCAAAATTAGGAGGG + Intergenic
933533171 2:83536088-83536110 AAGTAGGAGCTTAAAGTTGCAGG + Intergenic
933630393 2:84649822-84649844 AAGTGGGAGCTGAAAAATGATGG + Intronic
934489451 2:94750353-94750375 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
935141158 2:100354177-100354199 CAGTAGGGGCAAAATCATGATGG + Intergenic
935502041 2:103853575-103853597 AGTTAGAAGCTAAATGCTGAAGG + Intergenic
936821728 2:116530182-116530204 AAAAAGGAGCCAAATGATAATGG + Intergenic
937060064 2:118974463-118974485 AAGGAGGAGGAAAATGATTAAGG - Intronic
937700812 2:124861072-124861094 GAGTAGGTGCTCAATCATGATGG + Intronic
938647981 2:133350903-133350925 AAGTAGGAGCTGACAGGTGAAGG - Intronic
940125808 2:150322748-150322770 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
940312542 2:152293751-152293773 AGGCAGGAGCATAATGATGAAGG - Intergenic
941275276 2:163483170-163483192 AAGTGAGAGCAAAGTGATGAAGG + Intergenic
942762860 2:179420408-179420430 AAGTGGGAGCTAAATGATGAGGG + Intergenic
943241603 2:185391280-185391302 AGGCAGGAGCTAAATAATGCAGG - Intergenic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
945399107 2:209357612-209357634 CAGTAGGAGCTAAATAACAAAGG + Intergenic
946279587 2:218657181-218657203 CAGCAGGAGCCAGATGATGAAGG - Intronic
946868591 2:224065343-224065365 AAGTAGAAGGTAGATGATGGAGG + Intergenic
1169937550 20:10900570-10900592 AAGCAGGTGCTACATGACGAAGG + Intergenic
1170763439 20:19271769-19271791 AAGTGGGAGCTAAGCTATGAGGG + Intronic
1170950300 20:20930690-20930712 AAGTAGCAGGTAAATGGGGAAGG - Intergenic
1173065617 20:39707910-39707932 GGGTAGGACCAAAATGATGAAGG - Intergenic
1173681254 20:44884039-44884061 AAATAGCAGCTAAAGGATAAGGG + Intergenic
1174847543 20:53957746-53957768 AATTCTGAGATAAATGATGACGG + Intronic
1175412612 20:58780777-58780799 AGATAAGAGCTAAATCATGAAGG - Intergenic
1176840505 21:13838501-13838523 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1176919011 21:14664083-14664105 AATTAGGAGCTACAATATGATGG + Intergenic
1177938265 21:27377244-27377266 CAGTAGGAGCTATATGTTAAAGG - Intergenic
1178363083 21:31966117-31966139 AAGTGGGAGCTAAGCTATGAAGG - Intronic
1179146213 21:38770030-38770052 AAATAGGAGCTGAATAATTAGGG - Intergenic
1180202732 21:46235580-46235602 ATGTACGAGCTAAATGAGGCTGG - Intronic
1181018675 22:20086585-20086607 AATTTGGAGCTAGATGAAGAAGG + Exonic
1182019752 22:27071543-27071565 AAGTAGGATCTCACTGATGAAGG + Intergenic
1182100792 22:27656031-27656053 AAGAAGGGATTAAATGATGATGG + Intergenic
1182837644 22:33357283-33357305 AAGTGGGAGCTAAATAGTGAGGG + Intronic
1182859381 22:33546172-33546194 AGGTAGGAGCTAGGTCATGAAGG - Intronic
1182922604 22:34093904-34093926 AAGTGGGAACAAAATGCTGAAGG - Intergenic
1203293404 22_KI270736v1_random:17453-17475 TAGTTGGAGCTAATTGATGAAGG + Intergenic
951407069 3:22314330-22314352 AAGTGGGAGCTAAGCTATGAGGG - Intronic
952342470 3:32457656-32457678 AAGTAGTAGCTAATGGATGATGG + Intronic
952692959 3:36231354-36231376 AAGTATGAGCAAAAGTATGAAGG + Intergenic
955332563 3:58059796-58059818 AAGTAGGGGGAAAATGCTGAGGG - Intronic
956408995 3:68959236-68959258 AAGTAAGATATACATGATGAAGG - Intergenic
956708014 3:72016005-72016027 AAGTAGCACCTAAACGATAAAGG + Intergenic
957118274 3:76055554-76055576 AAGTAGGAGCTAAATAATGGGGG - Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
958152569 3:89709605-89709627 AAGTGGGAGCTAAGCTATGAAGG + Intergenic
958661381 3:97071927-97071949 AAGTAGGAACTAAGCTATGAGGG - Intronic
959338786 3:105100933-105100955 AAGTAGAAGAAAAATGTTGATGG - Intergenic
959347637 3:105219218-105219240 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
962034933 3:131641939-131641961 ATGTGGGAGCTAAACTATGAGGG + Intronic
962503542 3:136021172-136021194 ATTTAGGAGATAAATAATGAGGG + Intronic
963189549 3:142454096-142454118 AAGCAGGGGCTAGATTATGAAGG - Intronic
963688062 3:148463200-148463222 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
964325438 3:155541168-155541190 AAGTGGGAGCTAAGCTATGAGGG + Intronic
964575921 3:158168245-158168267 TGGTAGAAGCTAAATGATCAAGG - Intronic
964767991 3:160197213-160197235 CAGTAGGAGCTAAGTGATACAGG - Intergenic
966153881 3:176894962-176894984 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
966160608 3:176963640-176963662 AAGTGAGCGATAAATGATGAAGG - Intergenic
967315642 3:188149946-188149968 AAGTAGGTGCCAAATTATGAAGG + Intergenic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969864475 4:10065065-10065087 AAGAAGCAACTAAATGATGTGGG - Intergenic
972399859 4:38690710-38690732 AAGTTGGAGGAAAATGATGCAGG - Intronic
974316233 4:60284790-60284812 AAGAAGGAGGAAAAAGATGAGGG - Intergenic
975425601 4:74223399-74223421 AAGTAGGAGCTAAATGATGAGGG + Intronic
975511935 4:75203645-75203667 AAGTGGGAGCTAAATAAAGTGGG - Intergenic
975928317 4:79487004-79487026 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
978782682 4:112573335-112573357 AAGTGGGAGCTAAGTTATGAGGG + Intronic
978862736 4:113470290-113470312 AAGTAGGAGCAAAATGGGGGGGG - Intronic
979253670 4:118590415-118590437 AAGTAGGAGCAAGAGGATGGGGG - Intergenic
980134585 4:128847265-128847287 AAGCAGCAGCCAACTGATGATGG - Intronic
982805574 4:159758672-159758694 AGGTGGGAGCTAAAAGAGGAGGG + Intergenic
983281065 4:165681315-165681337 AAGTTGGACCTAGAGGATGAAGG + Intergenic
983447299 4:167869552-167869574 ACGTGGAAGCTAAATGATGAGGG - Intergenic
984128395 4:175841118-175841140 AAGTGGCTGCTAAATTATGAAGG + Intronic
984348090 4:178557457-178557479 AAGAAGGAACTAATTGATAATGG + Intergenic
984535534 4:180970070-180970092 AAGTAGCAGCAAAAAGAAGAGGG - Intergenic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
984737941 4:183128575-183128597 AAGTAGAAAGTAAATGATGAAGG - Intronic
986624291 5:9709014-9709036 AAGAAAGAGCTAAAGGATAAAGG - Intronic
988034516 5:25808575-25808597 AAGTATGTGAGAAATGATGATGG + Intergenic
988986837 5:36628423-36628445 AACTAGGAGCTAAAGGCTGGGGG - Intronic
989496935 5:42120221-42120243 AAGTAGGGGCTGAACTATGAGGG + Intergenic
989620603 5:43380165-43380187 GAATAGGAGCTAAAAGATGTAGG + Exonic
989757032 5:44967854-44967876 AAGTAGGAGTTAAATCTTTAGGG + Intergenic
990591046 5:57265501-57265523 AAGTTGAATCTAGATGATGAGGG + Intergenic
990673144 5:58155122-58155144 ACGTAGGAGCTAAGATATGAGGG + Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994303296 5:98172633-98172655 AATTAGAAGCTAAATTATCAGGG - Intergenic
995288891 5:110426304-110426326 GAGTATGAGCTACATGATCATGG + Intronic
995295694 5:110518814-110518836 AAGAAGGTGCTAAATCATGTGGG - Intronic
995498828 5:112780366-112780388 AAGTATGAGCTTAAGAATGATGG + Intronic
995800416 5:115988035-115988057 AACCAGCAGCTAAATGGTGATGG - Intronic
996692498 5:126355576-126355598 AAGCATGAGCTAAATGAGGCTGG + Intergenic
997189522 5:131917888-131917910 GAGTAGATGCTAGATGATGAGGG - Intronic
997290426 5:132729061-132729083 AAGTAGGAGCTAAGCTAGGAGGG + Intronic
999297165 5:150466974-150466996 AAGGCGGAGCTAAGTGCTGAGGG - Intergenic
999376603 5:151091101-151091123 AAGTAGAAGCTAGATCATGAAGG - Intronic
999467824 5:151823675-151823697 AAGTTGGAGCCAAATGATGAAGG - Intronic
1000685002 5:164237831-164237853 AAGGAGGAGCTAATTTTTGAAGG - Intergenic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1003363084 6:5447190-5447212 GTCTAGGCGCTAAATGATGAGGG + Intronic
1004878312 6:19978795-19978817 GACAAGGAGCTGAATGATGATGG - Intergenic
1006274873 6:32995710-32995732 AAGGAGGAGAGAAAGGATGAAGG - Intergenic
1008375003 6:50781464-50781486 AAGTAGGAGCTGGATGGTGATGG - Intergenic
1008469884 6:51872735-51872757 CAGAAGGAGCTACAAGATGATGG + Intronic
1009951848 6:70406151-70406173 AGGTAGGTGCTAAATTGTGAAGG + Intergenic
1011004430 6:82628302-82628324 AGTTAGGACCTAGATGATGATGG + Intergenic
1013092209 6:106910512-106910534 GGATAGGAACTAAATGATGATGG + Intergenic
1013381363 6:109574916-109574938 AAGTGAGAGCTAAACTATGAGGG - Intronic
1014450257 6:121573594-121573616 AAGTTGGAGATAAAGGAAGAAGG + Intergenic
1014858614 6:126434291-126434313 AATCAGCAGTTAAATGATGAGGG + Intergenic
1015917167 6:138228912-138228934 AAGTCAGAGCTAAGTGAAGAGGG + Intronic
1016224772 6:141721970-141721992 AAGTAGGAGGTAAGTGAAGAAGG - Intergenic
1019112428 6:169726515-169726537 AAGAATGAGATAAATGAAGATGG + Intergenic
1020616777 7:10468340-10468362 AAGCTGGAGCCAAATTATGAAGG - Intergenic
1020804160 7:12767480-12767502 AAGAAGTAGCCAGATGATGATGG + Intergenic
1021280667 7:18713706-18713728 CATAAGGAGCTAAATGATCATGG + Intronic
1023457560 7:40358168-40358190 ATGTGGGAGCTTAAAGATGATGG + Intronic
1027487260 7:78777553-78777575 GAGTAGGAGAAAGATGATGATGG - Intronic
1030808639 7:113947081-113947103 AAGTTGGAGCTAAGCTATGAGGG - Intronic
1035473258 7:159124913-159124935 AACTAGGAGCCAAATCAGGAAGG - Intronic
1035820613 8:2587738-2587760 AAGTAGGAGCAAAGCTATGAGGG - Intergenic
1036990531 8:13588008-13588030 AAGTAGGACCTATATAATAAAGG - Intergenic
1037297282 8:17413969-17413991 CAGTTGGAGCTAAATAAAGAGGG - Intergenic
1037625910 8:20606838-20606860 AAGTGGGAGCTAAGCCATGAGGG - Intergenic
1037674185 8:21040205-21040227 AAGTCGGAGCTCCCTGATGAAGG - Intergenic
1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG + Intronic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1038912543 8:31982611-31982633 AGGTAGGGGCCAAATTATGAAGG + Intronic
1039361117 8:36877831-36877853 AGATAGGAGCTATATGATAACGG - Intronic
1039397761 8:37241684-37241706 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040712141 8:50201846-50201868 AAGAAGAAGCTAAATGATTCAGG - Intronic
1041111400 8:54486327-54486349 AAATAGGATCTAAATGTTGGAGG - Intergenic
1041430248 8:57773415-57773437 AAGTGGGAGCTAAACATTGAGGG + Intergenic
1042886221 8:73554820-73554842 AAGTAGGAGCCAGATTATTAAGG - Intronic
1043144464 8:76635146-76635168 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1043286953 8:78544189-78544211 AAGTTGGAGCAAAAACATGAAGG - Intronic
1043652016 8:82607995-82608017 AAGTGGGAGCTAAACAATGGGGG - Intergenic
1044204753 8:89479985-89480007 AATTAAGTGCTAAATGAAGAGGG + Intergenic
1047393467 8:124473606-124473628 AAGCAGTAGATAAATGATGGCGG + Intergenic
1048526534 8:135208088-135208110 AAATGGGAGTTAAATGAGGAAGG + Intergenic
1048571272 8:135659148-135659170 AGGTAGGAGGAAAATCATGAAGG - Intergenic
1048715475 8:137264024-137264046 AAGCAGAAGCTAAATTATGGAGG + Intergenic
1050167131 9:2777042-2777064 AAGTGGGAGCTGAACAATGAGGG + Intronic
1050409160 9:5343666-5343688 AAGTGGGAGCTAAGCTATGAGGG + Intergenic
1051671752 9:19517427-19517449 AAGGAAGAGAGAAATGATGAGGG + Intronic
1055114524 9:72592522-72592544 AAGTAGGGGGTAAATTCTGAAGG - Intronic
1055966007 9:81865903-81865925 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1057865044 9:98673890-98673912 GAGGAGGAGATAAATGATAATGG + Intronic
1058111217 9:101032364-101032386 ATGTAGGTGTTAAATGATGAGGG + Intronic
1060534965 9:124378402-124378424 AAGTAGCAGCTGAATGCTGCTGG - Intronic
1062691363 9:137843433-137843455 AAATGGGAACTAAATGATGAGGG - Intronic
1186336513 X:8595483-8595505 AAGTGGGAGCTAAAGGAAGATGG + Intronic
1187599996 X:20818684-20818706 AAGTAGGAGCGAAGCTATGAGGG + Intergenic
1187920886 X:24200190-24200212 AAGTAAGAAGTAAGTGATGATGG + Intronic
1188523327 X:31062158-31062180 AACTAGGAGCTAAAGAATCAAGG + Intergenic
1188734245 X:33692929-33692951 CAGAAGAAGCTAAATCATGATGG - Intergenic
1189265018 X:39708482-39708504 AACTGGAAGCTAAAAGATGATGG + Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189935664 X:46065940-46065962 AAGTGGGAGCTAAATGATGAGGG - Intergenic
1191892877 X:65962795-65962817 AAGTAGGTGCTATATGAGAATGG - Intergenic
1192904358 X:75534549-75534571 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1192944605 X:75951638-75951660 AAGTGGGAGCTAAGCTATGAGGG - Intergenic
1193213524 X:78836376-78836398 AAGGAGGAGCCAAATTATGAAGG + Intergenic
1193654374 X:84181882-84181904 AAGTAGGAGATATATGAAAAGGG - Intronic
1193680760 X:84516341-84516363 AAGTGGGAGCTAAACTATGAGGG - Intergenic
1194797411 X:98228724-98228746 AAGTAGGAGCCAGATCTTGAAGG + Intergenic
1194961302 X:100238738-100238760 AAGTGGGAGCTAAAAATTGAGGG - Intergenic
1195173132 X:102288397-102288419 AAGTGGGAGCTAACCTATGAGGG - Intergenic
1195185734 X:102398698-102398720 AAGTGGGAGCTAACCTATGAGGG + Intronic
1195872660 X:109502019-109502041 ATGTTGGAGCAAAATCATGAGGG + Intergenic
1197850108 X:130849472-130849494 CAGTAGGTGCTTAATGGTGATGG - Intronic
1198115507 X:133541009-133541031 AAGTAAGAGCCAAATCATGGTGG + Intronic
1201426884 Y:13860916-13860938 AAGTGAGAGCTAAAAGAAGATGG - Intergenic
1201678145 Y:16611267-16611289 AAGTAGGAGCTAAGCTGTGAGGG + Intergenic