ID: 975428031

View in Genome Browser
Species Human (GRCh38)
Location 4:74253685-74253707
Sequence GCATGAGCAAGCCTGGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975428031_975428035 10 Left 975428031 4:74253685-74253707 CCATAACCCAGGCTTGCTCATGC 0: 1
1: 0
2: 0
3: 9
4: 217
Right 975428035 4:74253718-74253740 TTCATGCCCACCGCAGAACCAGG 0: 1
1: 0
2: 1
3: 7
4: 129
975428031_975428040 30 Left 975428031 4:74253685-74253707 CCATAACCCAGGCTTGCTCATGC 0: 1
1: 0
2: 0
3: 9
4: 217
Right 975428040 4:74253738-74253760 AGGCTAGCTCCTGTCGACCTAGG 0: 1
1: 0
2: 1
3: 9
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975428031 Original CRISPR GCATGAGCAAGCCTGGGTTA TGG (reversed) Intronic
901844440 1:11973002-11973024 GCAGGAGCCAGCCGGGGTCAAGG + Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
905187063 1:36204294-36204316 GGTTGAGAAAGCCTGGGATAGGG - Intergenic
905396338 1:37669080-37669102 TCAACAGCAAGCCTGGGTTTGGG - Intergenic
905920126 1:41713837-41713859 TGATGAGCAAGCCTGGGGGAGGG + Intronic
906798183 1:48713965-48713987 TTATGAGCAAGCCTTGGGTAGGG - Intronic
907461341 1:54607496-54607518 GCCTGAGCCACCCTGGGTAAGGG - Intronic
909421951 1:75476710-75476732 ACCTAAGCAAGCCTGGGTAATGG - Intronic
911394370 1:97287611-97287633 ACCTAAGCAAGCCTGGGTAATGG + Intronic
916689327 1:167175520-167175542 GGGTGAGCAAGCCTGGAGTAGGG + Intergenic
917549352 1:176007901-176007923 ACCTAAGCAAGCCTGGGTAATGG + Intronic
917774621 1:178320351-178320373 GCCTAAGCAAGCCTGGGCAATGG + Intronic
917848981 1:179043805-179043827 ACATGAGCAAGAGTGGGTCAGGG + Exonic
918035971 1:180872374-180872396 GCCTAAGCAAGCCTGGGCAATGG + Intronic
919319253 1:196014039-196014061 TCATGACTAAGCCTGGGATATGG - Intergenic
920175746 1:204100766-204100788 CGATGAGCGAGCCTGTGTTAGGG + Intronic
920186086 1:204160361-204160383 GGGGGAGCAAGCCTGGGCTACGG - Intronic
920574891 1:207052312-207052334 GGATGATACAGCCTGGGTTAGGG + Intronic
921981448 1:221263197-221263219 GCAGCAGCAAGGCTGGGTGAGGG - Intergenic
922352733 1:224747694-224747716 GCATGAGAGAGTCTGGCTTATGG + Intergenic
924520588 1:244802885-244802907 GAATGAGAAAGGCTGGGTTTTGG - Intergenic
924538778 1:244961497-244961519 GACTGTGCAGGCCTGGGTTATGG - Intergenic
924637126 1:245798863-245798885 GCCTGAGCAAGGCTGGGCTGAGG - Intronic
1063253728 10:4303240-4303262 ACATGAGCCATCCTGGATTAGGG + Intergenic
1063435053 10:6022611-6022633 GCAGGAGCCAGCCTGGGACAGGG - Intronic
1064761697 10:18627842-18627864 GCCTAAGCAAGCCTGGGCAATGG - Intronic
1065548335 10:26844811-26844833 GAATCAGCAAGCCTTGGTGAAGG - Intronic
1066279880 10:33906336-33906358 GCACGAGACAGCCTGGCTTAGGG - Intergenic
1066393568 10:34998146-34998168 GAATGAGCAGGGCTGGGCTATGG - Intergenic
1066934016 10:41803435-41803457 ACATAAGCAAGCCTGGGCAATGG + Intergenic
1067226426 10:44379207-44379229 GCATGAGGAAGCCTGGAGGAAGG + Intronic
1069119844 10:64556095-64556117 GCATGAGCAATTCTGGTTGAGGG - Intergenic
1070287534 10:75094726-75094748 GCCGGAGGAAGCCTGAGTTAGGG + Exonic
1072361394 10:94663272-94663294 GCAGCAGCAAGCCTGGGGGAGGG - Intergenic
1073494730 10:103880518-103880540 TCAGGAGCAAGCCTGGGGTCAGG + Intergenic
1073849444 10:107597642-107597664 GCAGGAGAAAGCCTGGGGAATGG - Intergenic
1073991379 10:109266011-109266033 GCATCAGGAAGCCTGAGTTCTGG - Intergenic
1074780111 10:116796489-116796511 GCAGGAGCAGGCCTGGGGCAGGG - Intergenic
1077643124 11:3900116-3900138 GCCTAAGCAAGCCTGGGCAATGG + Intronic
1078021912 11:7663705-7663727 ACCTAAGCAAGCCTGGGTAATGG + Intergenic
1080787991 11:35493514-35493536 GCAAGAGGAAGCATGGGTTTTGG - Intronic
1081729240 11:45357341-45357363 GGATGATGATGCCTGGGTTAGGG - Intergenic
1082568922 11:54714267-54714289 GCAGCAGCAAGGCTGGGGTAGGG - Intergenic
1082642867 11:55686088-55686110 ACCTAAGCAAGCCTGGGTGATGG - Intergenic
1083524537 11:63349968-63349990 ACATAAGCAAGCCTGGGCAATGG + Intronic
1085471092 11:76758618-76758640 GCAGGAGCAGGCCTGGGTCTCGG + Intergenic
1086508181 11:87527897-87527919 GTATGAGCAAGCATGGGGTCTGG + Intergenic
1086946954 11:92853174-92853196 ACATGAGCAAGCATGGGGTTCGG + Intronic
1087224020 11:95577888-95577910 GCATGAGTAAGTCTTAGTTAAGG - Intergenic
1088204148 11:107373205-107373227 ACCTGAGCAAGCCTGGGCAATGG - Intronic
1089537489 11:119169425-119169447 GCCTGAGAAAGCCTAGGTTCCGG - Intronic
1090082441 11:123623051-123623073 GCCTGGGGAAGCCTGGGGTAGGG - Intronic
1094207441 12:27855310-27855332 GCAGGAGTAAGCCTGGGAGATGG - Intergenic
1096153830 12:49331017-49331039 GCATGAGATTGCCTGGGGTAGGG - Intronic
1097242344 12:57584055-57584077 GGAGGTGCAAGCCTGGGTCACGG + Intronic
1098935521 12:76474372-76474394 GCAAGAGCAAGCTTGGGATGGGG + Intronic
1101769755 12:107738096-107738118 TCATGAGCAAGCCTGGAAGAGGG - Intronic
1103571241 12:121846610-121846632 GTATCAGGAAGCCTGGGTGATGG - Intronic
1104556125 12:129801149-129801171 ACCTGAGCAAGCCTGGGCAATGG - Intronic
1108296081 13:49019159-49019181 ACCTGAGCAAGCCTGGGCAATGG + Intronic
1111746794 13:92281181-92281203 GCGTCAGCAAGGCTGGGGTAGGG + Intronic
1111782995 13:92752924-92752946 GCCTAAGCAAGCCTGGGCAATGG - Intronic
1112212236 13:97389252-97389274 GAATGGGCAAACGTGGGTTATGG - Intronic
1114885509 14:26844858-26844880 ACATGAGCAAGGCTTGGTTTGGG - Intergenic
1116618707 14:47172105-47172127 AGCTGAGCAAGCCTGGGCTATGG - Intronic
1117868212 14:60171219-60171241 GATTGAGCAAGCATGGGGTATGG - Intergenic
1118760080 14:68875574-68875596 TCATGAGCAAACCTGGGAGAAGG - Intronic
1120863850 14:89278531-89278553 GCAGAAGCCAGCCGGGGTTATGG - Intronic
1121117377 14:91353181-91353203 GGATCAGCAAGCCTGGGGCAAGG - Intronic
1122647519 14:103205204-103205226 GCCTGAGCAGGCCTGGGCTGCGG - Intergenic
1126181016 15:45785141-45785163 GCATGGGCAAGGGTGGGTTGGGG - Intergenic
1126888981 15:53183658-53183680 GCAGCAGCAAGCCTGGGGGAGGG + Intergenic
1130695767 15:86129772-86129794 GCTTGAGAAAGCCTGCATTAGGG + Intergenic
1134853132 16:17498328-17498350 GCATCAGCATGCCTGGGTCAGGG - Intergenic
1136233612 16:28902104-28902126 CCAGGAGGAAGCCGGGGTTAGGG + Intronic
1139710006 16:68768916-68768938 GCATGAGGATGCCTGGGGGAAGG - Intronic
1139949175 16:70660893-70660915 GCCTCTGCAAGCCTGGGTTGGGG + Intergenic
1144727054 17:17507280-17507302 GCATGGGCAGGCCTGGGCCAGGG + Intronic
1148480452 17:47956574-47956596 CCATTAGCAAGCCTGACTTATGG + Intronic
1150621761 17:66812863-66812885 CCATGAGGAAGGCTGGGTGATGG - Intergenic
1151884919 17:76917868-76917890 GGATGAGAAAACCTGGGTTCGGG + Intronic
1155249854 18:23944215-23944237 GCATGAGGCAGCCTGGGGGAGGG - Intronic
1156444565 18:37225814-37225836 GCAGGTGCCAGCCTGGGTTGGGG - Intronic
1157320497 18:46630455-46630477 GCATGAGCAAGACCTGTTTAAGG - Intronic
1158721848 18:59932060-59932082 GGCTGAGCAAACTTGGGTTATGG + Intergenic
1161176361 19:2844701-2844723 GCATAAGCTAGCCTGGATTTGGG - Intronic
1162785934 19:13034791-13034813 GCATGACTAAGGCTGGGTTCAGG + Intronic
1164857620 19:31537286-31537308 GCAGCAGTAAGACTGGGTTATGG - Intergenic
1165730208 19:38140326-38140348 GCATGTGCCAGCCTGGTCTAGGG + Intronic
1166158419 19:40933181-40933203 GCATGAGCAAGTGTGTGTCAAGG + Intergenic
1166248832 19:41551595-41551617 CCATGAGCCTGCCTGGGTTTAGG + Intronic
1167120483 19:47513805-47513827 GCCTGAGGAGGCCTGGGTTGAGG - Intronic
1167649365 19:50721067-50721089 GAATGAGGAAGCCTGGGCTAAGG - Intergenic
1167794010 19:51697402-51697424 GCATGGGCAAGCCTGGCACACGG - Intergenic
1168447449 19:56432690-56432712 GAATGATTAAGTCTGGGTTAAGG - Intronic
927398971 2:22688826-22688848 ACATGAGCACGCCTGGCTTGGGG - Intergenic
931835291 2:66092629-66092651 GACTGAGCAAGTCTGGGGTAGGG + Intergenic
932368997 2:71172397-71172419 CAAAGAGAAAGCCTGGGTTATGG - Intergenic
933516416 2:83309342-83309364 GCATGAGAGAGAGTGGGTTATGG - Intergenic
937983093 2:127626348-127626370 GCAAGAGCGAGCCTGGGCTGGGG + Intronic
938534928 2:132231773-132231795 ACCTAAGCAAGCCTGGGTAATGG - Intronic
938814239 2:134883418-134883440 ACATGAGGAATCCTGGGTTAAGG - Intronic
940038521 2:149334429-149334451 GCTTGAGAAAGCCTGGGTGTAGG - Intronic
940997800 2:160168976-160168998 GGATGAGAAAGACTGAGTTAAGG - Intronic
941192541 2:162403654-162403676 GCATGAACTTGCCTAGGTTAAGG + Intronic
942115092 2:172720930-172720952 TCATGAGAAAGACTGGGTGAGGG - Intergenic
942735555 2:179107743-179107765 GCATGAGCAAGACTGGGAATAGG + Exonic
944182057 2:196906035-196906057 ACCTAAGCAAGCCTGGGCTATGG - Intronic
945187013 2:207149377-207149399 ATATGGGCAAGCCTGGGATATGG - Intronic
945853223 2:215035015-215035037 GAATGAGGTGGCCTGGGTTACGG + Intronic
946675491 2:222155164-222155186 ACCTAAGCAAGCCTGGGCTATGG + Intergenic
947264758 2:228266398-228266420 GCATCAGCTTGACTGGGTTAAGG + Intergenic
1169027206 20:2381173-2381195 GCCTGAGCCAGCCTGGGCCATGG - Intronic
1170090298 20:12582954-12582976 ACCTAAGCAAGCCTGGGTAATGG - Intergenic
1170892897 20:20391224-20391246 GCAGGATCAAGCCTGAGTGATGG + Intronic
1171040978 20:21763358-21763380 GCATGTGCAAGAGTGGGCTAGGG + Intergenic
1171514596 20:25719348-25719370 GCCTAAGCAAGCCTGGGCAATGG + Intergenic
1172694453 20:36812671-36812693 GCCTGAGCAAGCATGGGATTGGG - Intronic
1173354978 20:42278842-42278864 GCATGTGGAAGCTTGGGGTAGGG - Intronic
1173747201 20:45446939-45446961 GGCTGAGCAGGGCTGGGTTAGGG - Intergenic
1175230812 20:57472038-57472060 CCATGAGCCAGCGTGGCTTATGG + Intergenic
1176960477 21:15153753-15153775 GCATGTGCAAGGGTGGGTGATGG + Intergenic
1176973143 21:15289374-15289396 GCATGAGCAAGCGTGGGGTCCGG + Intergenic
1179102348 21:38365376-38365398 GCAAGTGCAAGACTGGGTGATGG - Intergenic
1179323844 21:40320031-40320053 GCATGTGAAAGCATGGGTAAGGG + Intronic
1179503316 21:41823278-41823300 CCGTGAGCATGCCTGGGTGAGGG + Intronic
1180018122 21:45100851-45100873 GGATGAGCAGGCCTGGTTTGGGG + Intronic
1180220333 21:46354590-46354612 GCATGAGCAAGCCCGGTGTCGGG + Intronic
1180981128 22:19878512-19878534 GCATGGGCAAGGCAGGGTCATGG + Intronic
1181293564 22:21817206-21817228 GCATGGGCATGTCTGGGTGAGGG - Intronic
1181537291 22:23553054-23553076 GCATGACAAAGCCTGAGTGAGGG - Intergenic
1182969134 22:34555239-34555261 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
1184015489 22:41782878-41782900 GAATGATCAGGCCTGAGTTAGGG - Intronic
1185232431 22:49690817-49690839 GGAGGAGCAAGTCTGGGTAATGG + Intergenic
950446372 3:13041202-13041224 GCATGAACAAGCCTGGGGGCGGG + Intronic
953421141 3:42754222-42754244 GCAGGAGCAAGCCTGGGCTGAGG - Intronic
954622180 3:52002565-52002587 GCCTGAGCAGGCCTGGGCTGGGG + Intergenic
955243739 3:57204490-57204512 GGATGTGAAAGCCTGGGCTAGGG + Intronic
955667335 3:61364418-61364440 GCATCAGCGAGCCTGGGGGAGGG + Intergenic
956168766 3:66416366-66416388 GCATTCGCAAGGCTGGTTTAGGG - Intronic
956851690 3:73233904-73233926 CCATAAGCAAGCTTGGTTTATGG + Intergenic
960919661 3:122733321-122733343 ACATAAGCAAGCCTGGGCAATGG - Intergenic
963483481 3:145905116-145905138 GTGTGAACAAGCATGGGTTATGG - Intergenic
964563136 3:158020124-158020146 ACCTGAGCAAGCCTGGGCAATGG - Intergenic
967936971 3:194736744-194736766 GGAAGAGCAAGACTGGGTTGGGG - Intergenic
969498945 4:7541527-7541549 CCATAAGCAAGCCTGGCTCAGGG - Intronic
969807157 4:9618028-9618050 GCAGGAGCAAGGCTGGGGGAGGG + Intergenic
970654388 4:18214949-18214971 GCAGGAGCAAGGCTGGGTGGAGG + Intergenic
971247057 4:24938828-24938850 GCATCAGCGAGGCTGGGTGAGGG + Intronic
971278835 4:25224228-25224250 GCCTGAGCAGGCCTGGGCTGTGG - Intronic
973166501 4:47084386-47084408 GTATGAGCAATCCTGGTTTGAGG - Intronic
973541522 4:51940640-51940662 ACCTAAGCAAGCCTGGGTAATGG + Intergenic
974536498 4:63182168-63182190 GCAGTAGCAAGGCTGGGTCAGGG + Intergenic
975428031 4:74253685-74253707 GCATGAGCAAGCCTGGGTTATGG - Intronic
975428054 4:74253807-74253829 GCATGGGCAGGCCTGGGTCCTGG - Intronic
978626680 4:110693220-110693242 ACCTAAGCAAGCCTGGGTAATGG + Intergenic
979709067 4:123756084-123756106 GCAAGAGCATTCCTGGGTGAGGG - Intergenic
981610555 4:146589753-146589775 GCAAGAGTATGCCTGGGGTATGG + Intergenic
983379991 4:166980603-166980625 GCATGAGCAAGCGTGGGGTCCGG + Intronic
986936868 5:12899994-12900016 GCATGAGCAAAAATGGGTGAAGG + Intergenic
988640371 5:33034974-33034996 CCATGAGCATGTCAGGGTTACGG - Intergenic
989816956 5:45748725-45748747 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
989942864 5:50174497-50174519 ACATAAGCAAGCCTGGGCAAGGG + Intergenic
990648407 5:57870418-57870440 GCCTAAGCAAGCCTGGGCAATGG + Intergenic
991167602 5:63582241-63582263 ACCTAAGCAAGCCTGGGTAATGG - Intergenic
992012438 5:72541966-72541988 GCATGAGCAGGAATGGGATATGG + Intergenic
993370323 5:87084841-87084863 GCGGCAGCAAGCCTGGGTGAGGG + Intergenic
993996597 5:94730484-94730506 GCAGGAGCAAGCTTGGGAAAAGG + Intronic
995025260 5:107413156-107413178 GAATGAGGAGGCCTGGGTTTTGG - Intronic
996609735 5:125364566-125364588 GCCTAAGCAAGCCTGGGCAATGG + Intergenic
996773386 5:127108785-127108807 GCCTAAGCAAGCCTGGGCAATGG + Intergenic
999233006 5:150073322-150073344 GCATTAGCAAGCTTGGGCTCAGG + Exonic
999420841 5:151441017-151441039 GCATCAGAAACCCTGGGTTGTGG - Intronic
999493836 5:152077285-152077307 ACCTAAGCAAGCCTGGGCTATGG - Intergenic
999528900 5:152439796-152439818 GCAGGTACAAGCCTGGGTTTAGG - Intergenic
1001952563 5:175826441-175826463 GCATGAGCATACCTGGGGTGGGG + Intronic
1006927253 6:37663938-37663960 GCCTGAGCAAGGCTGGGCTGGGG + Intronic
1007547805 6:42707745-42707767 GCATGAGGTGGCCTGGGTCATGG + Intronic
1008297600 6:49797041-49797063 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
1008349436 6:50472742-50472764 GCATCAGCACCACTGGGTTACGG - Intergenic
1009870743 6:69450072-69450094 GAATGAGCAAGCATGGGGTCTGG + Intergenic
1010163400 6:72886083-72886105 GCATGAGCTAGCATGAGTGAGGG + Intronic
1010896304 6:81368663-81368685 ACATAAGCAAGCAGGGGTTAAGG + Intergenic
1013747105 6:113358814-113358836 GCGTGAGCAGGGCAGGGTTAGGG + Intergenic
1015573216 6:134643635-134643657 GCATGAGCAAGCCTTGGTCTCGG - Intergenic
1018854050 6:167662919-167662941 CCGTGAGCCAGCCTGGGTTCTGG + Intergenic
1019029977 6:169001487-169001509 CCTTGAGCAAGGCAGGGTTAGGG + Intergenic
1019524153 7:1473225-1473247 GCAGGAGGAAGGCTGGGTCAGGG + Intronic
1019888209 7:3923916-3923938 GCATGAGCAAGCCCTGTCTAAGG - Intronic
1022441863 7:30439690-30439712 ACCTAAGCAAGCCTGGGCTATGG - Intronic
1023876788 7:44290523-44290545 CCATGAGGAGGCCTGGGCTAGGG + Intronic
1024022271 7:45383088-45383110 GCAGCAGCAAGCCTGGGGGAGGG - Intergenic
1026725954 7:72870089-72870111 GCATGAGAAAGCTTGGTTTCGGG - Intergenic
1026788691 7:73318161-73318183 GCATGATCCAGCCTGGGTGACGG - Intronic
1029309797 7:99652502-99652524 GCTTGAACCAGCCTGGGTCAGGG + Intronic
1031044311 7:116870598-116870620 GGATTGGTAAGCCTGGGTTATGG - Intronic
1031130154 7:117824126-117824148 GCAAGAGCAAGCCTGAGGTCAGG + Intronic
1031973651 7:128080704-128080726 GCATGAGATAGCCTGGGATCTGG + Intronic
1034676564 7:152896425-152896447 GAGTGTGCAAGCCTGGGGTACGG + Intergenic
1036753390 8:11456936-11456958 GTATGAGCGGGGCTGGGTTAGGG + Intronic
1038499077 8:28028522-28028544 GGATCAGCCAGCCTGGGTTGAGG + Intronic
1039462587 8:37758168-37758190 ACCTGAGAAAGCCTGGGCTAGGG - Exonic
1040063485 8:43124866-43124888 GCCTGAGCAGGCCTGGGCTGCGG - Intergenic
1040554372 8:48466250-48466272 GTTTGAGCAAGCCTGAGGTAGGG - Intergenic
1040989857 8:53338103-53338125 ACCTAAGCAAGCCTGGGCTATGG - Intergenic
1042476542 8:69254666-69254688 ACCTAAGCAAGCCTGGGCTATGG - Intergenic
1042620699 8:70700867-70700889 ACCTGAGCAAGCCTGGGCAATGG + Intronic
1048138678 8:131771349-131771371 ACATAAGCAAGCCTGGGCAATGG - Intergenic
1051713365 9:19956314-19956336 GCATCAAGAAGCCTGGGTTTTGG + Intergenic
1055654391 9:78438764-78438786 GGTTGAGGAAGCCTGGTTTAGGG - Intergenic
1056093555 9:83228491-83228513 ACCTGAGCAAGCCTGGGCAATGG + Intergenic
1056803254 9:89708625-89708647 GCATGAGCTGGCCTGGGGTCGGG - Intergenic
1060233598 9:121843619-121843641 GCATTAGCAGGCCTTTGTTATGG - Intronic
1060310235 9:122453068-122453090 GCAGGAGCAAGGCGGGGATACGG - Intergenic
1061514678 9:131082081-131082103 AGATGAGGAAGCCTGGGTCAGGG - Exonic
1187227338 X:17386266-17386288 GCATTAGGAAGCCTGGTTGAAGG - Intronic
1188818678 X:34746838-34746860 CCATGAGCAACCCTGGCTTAAGG - Intergenic
1190422738 X:50301841-50301863 GCAGCAGCAAGCCTGGGGGAGGG - Intronic
1191567252 X:62555886-62555908 ACATAAGCAAGCCTGGGAAATGG - Intergenic
1191728029 X:64302123-64302145 ACCTGAGCAAGCCTGGGCAATGG + Intronic
1191747233 X:64502766-64502788 ACCTAAGCAAGCCTGGGTAATGG + Intergenic
1193002973 X:76583513-76583535 ACCTAAGCAAGCCTGGGTAATGG + Intergenic
1195442081 X:104909910-104909932 ACCTAAGCAAGCCTGGGTAATGG + Intronic
1196566390 X:117210202-117210224 GCAAGGGCAAGCCTGGATTCTGG - Intergenic
1197486392 X:127056540-127056562 GCAGCAGCAAGGCTGGGGTAGGG - Intergenic
1198339615 X:135701148-135701170 GCATGAGCAGAGCTGGATTAAGG - Intergenic
1201397493 Y:13564826-13564848 GCCTAAGCAAGCCTGGGCAATGG + Intergenic