ID: 975429943

View in Genome Browser
Species Human (GRCh38)
Location 4:74277419-74277441
Sequence GCATCCTAGTAACTACAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975429943_975429952 29 Left 975429943 4:74277419-74277441 CCCCATTGTAGTTACTAGGATGC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 975429952 4:74277471-74277493 GAAAGTCACTGTTAAGTGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 176
975429943_975429951 25 Left 975429943 4:74277419-74277441 CCCCATTGTAGTTACTAGGATGC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 975429951 4:74277467-74277489 AAGAGAAAGTCACTGTTAAGTGG 0: 1
1: 0
2: 1
3: 29
4: 332
975429943_975429948 -1 Left 975429943 4:74277419-74277441 CCCCATTGTAGTTACTAGGATGC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 975429948 4:74277441-74277463 CCCCATTCTAGAACTACAATGGG No data
975429943_975429953 30 Left 975429943 4:74277419-74277441 CCCCATTGTAGTTACTAGGATGC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 975429953 4:74277472-74277494 AAAGTCACTGTTAAGTGGCAGGG 0: 1
1: 0
2: 0
3: 16
4: 200
975429943_975429946 -2 Left 975429943 4:74277419-74277441 CCCCATTGTAGTTACTAGGATGC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 975429946 4:74277440-74277462 GCCCCATTCTAGAACTACAATGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975429943 Original CRISPR GCATCCTAGTAACTACAATG GGG (reversed) Intronic
905114592 1:35626696-35626718 ACATCCTTGTAAGTAAAATGGGG + Intronic
910289373 1:85585383-85585405 TCATCCTAGTAAATATAATGAGG + Intergenic
911750262 1:101488327-101488349 GGATCTTGGTAGCTACAATGGGG + Intergenic
912029754 1:105225779-105225801 GCATCCCAGTCAAAACAATGTGG + Intergenic
913590071 1:120316005-120316027 GCATTCTATTAACTAAAATAGGG - Intergenic
913618114 1:120582361-120582383 GCATTCTATTAACTAAAATAGGG + Intergenic
914572099 1:148927862-148927884 GCATTCTATTAACTAAAATAGGG - Intronic
914600737 1:149202403-149202425 GCATTCTATTAACTAAAATAGGG + Intergenic
916765346 1:167854945-167854967 CCATCTTAGTATCTGCAATGAGG - Intronic
921174698 1:212583843-212583865 GAATCATAGTATCTACCATGTGG + Intronic
921499923 1:215888965-215888987 GCATCCTAGAAAATCCAATGGGG - Exonic
1065617486 10:27543415-27543437 GTATCAAAGTAACTAAAATGTGG - Intergenic
1069237850 10:66100358-66100380 GCTCCCTAGCAACTACTATGTGG - Intronic
1069354579 10:67569485-67569507 GAGTCCTAGAAACTAAAATGTGG + Intronic
1074413970 10:113250942-113250964 GCAGCATAGCAACTTCAATGAGG + Intergenic
1080435235 11:32234416-32234438 GCAAACAAGTAAATACAATGAGG + Intergenic
1082116648 11:48336527-48336549 GCTTTCTAGCAACTACCATGAGG + Intergenic
1082257147 11:50043783-50043805 GCTTTCTAGCAACTACCATGAGG - Intergenic
1093503964 12:19843327-19843349 GCACGCTACTAAATACAATGTGG - Intergenic
1096513417 12:52144196-52144218 GTGTCCTTGTAAGTACAATGGGG + Intergenic
1098287028 12:68917744-68917766 GCATCCTAGTACCTAGTTTGGGG + Intronic
1098591465 12:72218850-72218872 GCATCTTAGTAAATATAATTAGG - Intronic
1101627081 12:106455358-106455380 GCTGCCTAGCAACTACAAAGAGG - Intronic
1105036271 12:132924609-132924631 GCAACCTAGGAACTGCCATGCGG + Exonic
1107104418 13:36627732-36627754 GCATCCTAGTGAATGCGATGTGG + Intergenic
1109159258 13:58951447-58951469 ACAACTTAGTAACTCCAATGGGG - Intergenic
1110544789 13:76744392-76744414 GCTTCTTAGGACCTACAATGGGG - Intergenic
1116091602 14:40314286-40314308 GCATCCTAGTAAATAATATCAGG - Intergenic
1119489460 14:75018286-75018308 GCAACCTGCAAACTACAATGTGG - Intronic
1120000692 14:79300025-79300047 TCACCCTAGTAACTATAATGAGG + Intronic
1121907349 14:97758465-97758487 GCATCCTAGAAACTTCTAGGTGG - Intronic
1127143459 15:56000405-56000427 GAATCCTAGTTCCTACTATGGGG - Intergenic
1130114560 15:80995578-80995600 GCATCATAGTAGCTACAAGGGGG + Intergenic
1130901390 15:88209409-88209431 GCATCCTAGCCACTCCCATGTGG - Intronic
1131973878 15:97921309-97921331 GGTTCGTAGTAACTGCAATGTGG - Intergenic
1132217679 15:100079018-100079040 TCATCCTAGTGGGTACAATGTGG - Intronic
1135569252 16:23535697-23535719 GCATCCCAGTGACTAGGATGGGG - Intronic
1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG + Intronic
1142996439 17:3763373-3763395 CCACCCTAGTAACTAGCATGGGG - Intronic
1150117830 17:62569806-62569828 GCATCCCAGGAACTGAAATGCGG - Intronic
1150976933 17:70098101-70098123 GCATCCTGGGATCTAAAATGGGG - Intronic
1155916628 18:31564018-31564040 GCATCCTTGTATCTATAAGGAGG + Intergenic
1156941905 18:42777950-42777972 GCAACATAGTAACTCCAATTTGG + Intronic
1157681037 18:49607082-49607104 TCATCCTAGTGAGTACAAAGTGG - Intergenic
1165778841 19:38420531-38420553 GCGTCCTAGGAACTAGACTGGGG + Intronic
926073448 2:9920651-9920673 GAAACATAGTAACTACACTGTGG - Intronic
926596487 2:14795744-14795766 GCATGCTAGTAAATACCTTGCGG - Intergenic
927602109 2:24452519-24452541 GCATCCTATTAACTAGAAGGGGG - Intergenic
930916766 2:56700801-56700823 GCATTTTAGTAACTACTATTTGG + Intergenic
933149599 2:78897894-78897916 GCACCCTAGGAATTATAATGAGG - Intergenic
935152793 2:100453152-100453174 ACATTTTAGTAACTACAAGGGGG + Intergenic
937332036 2:121037689-121037711 GCATCCCAGGAACTACAAGAAGG - Intergenic
942808951 2:179973192-179973214 GCATCTTATTAACCAAAATGTGG - Exonic
943424206 2:187709121-187709143 GCATCTCAGTAAGTTCAATGTGG + Intergenic
1171352962 20:24518845-24518867 GCATCCTGGTGACAACAACGAGG + Intronic
1173953387 20:47011204-47011226 GTTTCCTCGTGACTACAATGAGG - Intronic
1183020183 22:35020615-35020637 GCTTCCTTGTTACTAAAATGGGG - Intergenic
949577936 3:5357056-5357078 GCTTCTTAGTAACAACTATGAGG - Intergenic
960499940 3:118425262-118425284 GCATCCTAGTAGATATAAAGTGG - Intergenic
963967061 3:151383967-151383989 GCATCCAAGTAAATAAGATGTGG - Intronic
965560410 3:170056853-170056875 CCATCACAGTAACTATAATGTGG + Intronic
967281794 3:187830251-187830273 ACATCCTAGGAACAACAAGGAGG - Intergenic
969981711 4:11163553-11163575 GGATCCTTGTAAATTCAATGGGG - Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
975429943 4:74277419-74277441 GCATCCTAGTAACTACAATGGGG - Intronic
977333964 4:95672660-95672682 ACATCCTAGTAATTAGAAAGAGG - Intergenic
978169678 4:105654583-105654605 AAATCCTATTAACTACAATATGG + Intronic
986812767 5:11377627-11377649 GCATCCTTGTAAATCAAATGCGG - Intronic
988225339 5:28405057-28405079 GCATCCTAGCTGCTGCAATGGGG - Intergenic
988258129 5:28848119-28848141 GCGTCCTAGAAACTTCACTGAGG - Intergenic
989155346 5:38339634-38339656 GCATCCTTGTCAGTAAAATGAGG - Intronic
990153993 5:52853786-52853808 GCATCCAAGTAATTGCAATGTGG + Intronic
994439699 5:99786869-99786891 TCATTTTAGTAAATACAATGGGG + Intergenic
1004100349 6:12603137-12603159 GGATCCCATTAACAACAATGGGG - Intergenic
1007242681 6:40438471-40438493 ACTTCCTAGTAGCTAAAATGGGG - Intronic
1007415085 6:41686999-41687021 CCATCCTAGTAACTAGCATGGGG + Intronic
1021054576 7:16031648-16031670 AAATCCTAGTCATTACAATGTGG + Intergenic
1046696358 8:117344141-117344163 GAATCCTACTAACTACTTTGTGG + Intergenic
1050652120 9:7787003-7787025 ACATCGTGGTACCTACAATGGGG + Intergenic
1053202384 9:36161623-36161645 GCATCCTAGAAACCAAAAGGGGG + Intronic
1060808393 9:126593652-126593674 GTATCCTAGTACCTAGGATGGGG + Intergenic
1061124141 9:128663176-128663198 TCATTCTAGTAACTACAAATAGG + Intergenic
1186179992 X:6964052-6964074 GCATTCTAGGAAGTAAAATGTGG + Intergenic
1188125419 X:26361882-26361904 GCTTACTAGTAATTACCATGAGG + Intergenic
1188279115 X:28240752-28240774 GAATCCTAGTAAGAACAATTAGG + Intergenic
1190244327 X:48681130-48681152 GCTTCCCAGTCAGTACAATGGGG + Intronic
1195511305 X:105718580-105718602 GCATCCTAGTGAGTATAAAGTGG - Intronic