ID: 975437019

View in Genome Browser
Species Human (GRCh38)
Location 4:74365076-74365098
Sequence GACCTCACCCCGTTAGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 47}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975437009_975437019 23 Left 975437009 4:74365030-74365052 CCTGCCGCTCCTCCCTCGGGCCA 0: 1
1: 0
2: 4
3: 62
4: 867
Right 975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 47
975437012_975437019 11 Left 975437012 4:74365042-74365064 CCCTCGGGCCAATTATGAAACTC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 47
975437010_975437019 19 Left 975437010 4:74365034-74365056 CCGCTCCTCCCTCGGGCCAATTA 0: 1
1: 0
2: 0
3: 7
4: 125
Right 975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 47
975437011_975437019 14 Left 975437011 4:74365039-74365061 CCTCCCTCGGGCCAATTATGAAA 0: 1
1: 0
2: 0
3: 4
4: 46
Right 975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 47
975437007_975437019 26 Left 975437007 4:74365027-74365049 CCTCCTGCCGCTCCTCCCTCGGG 0: 1
1: 0
2: 4
3: 62
4: 759
Right 975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 47
975437013_975437019 10 Left 975437013 4:74365043-74365065 CCTCGGGCCAATTATGAAACTCT 0: 1
1: 0
2: 0
3: 5
4: 58
Right 975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 47
975437016_975437019 3 Left 975437016 4:74365050-74365072 CCAATTATGAAACTCTGGGCACT 0: 1
1: 0
2: 0
3: 11
4: 127
Right 975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975437019 Original CRISPR GACCTCACCCCGTTAGGGCC CGG Intergenic
905726755 1:40258605-40258627 GACCCAATCCCTTTAGGGCCTGG + Intronic
907516658 1:54997257-54997279 GACCTCAGCCCGTCTGGCCCTGG - Intergenic
1067068917 10:43118755-43118777 GTCCTCACCCAGTTCGGGGCTGG + Intronic
1077056799 11:597804-597826 GCCCCCACCCCGCCAGGGCCAGG - Intronic
1077468114 11:2743347-2743369 GACCCCACCCCTTCAGGCCCTGG + Intronic
1081611325 11:44565219-44565241 GGCCTCACCCTACTAGGGCCGGG + Intronic
1082091611 11:48094935-48094957 GCCCTCACCCCCTCAGGGCTGGG - Intronic
1102949788 12:117023726-117023748 GTCCTCACCCGGTTAGGATCTGG + Intronic
1129693646 15:77728355-77728377 GAGCTCACCCTGTTCCGGCCAGG + Intronic
1141639582 16:85333495-85333517 CACCTCACCCCCTTAGGGCTTGG + Intergenic
1141681133 16:85544652-85544674 GACCTGAACCAGTTAGGCCCAGG + Intergenic
1142803656 17:2360442-2360464 GACCTCTCCCCGACAGGGACAGG - Intronic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1150193922 17:63274283-63274305 GACCTCTCCCCCGTTGGGCCGGG - Intronic
1152697728 17:81805001-81805023 GCCCTCACCCCGTGGGGGCGGGG - Intronic
1152862768 17:82705464-82705486 GAGCCCACCCCATTAGAGCCTGG + Intergenic
1160729661 19:635367-635389 GACCTCACTCTGGAAGGGCCTGG + Intergenic
1160822221 19:1063956-1063978 GCCCTCGCCCCACTAGGGCCAGG - Intronic
1162786299 19:13037018-13037040 GACCTCACCCTGTTCAGCCCAGG - Intronic
1166892723 19:46003490-46003512 GCCCTCACTCAGGTAGGGCCCGG + Exonic
1167551297 19:50162865-50162887 GACCTCACCCCCTCCAGGCCTGG + Intronic
929561666 2:42960200-42960222 CACTTCACCCCATCAGGGCCTGG - Intergenic
948976802 2:241468480-241468502 GAGTCCACCCCATTAGGGCCTGG + Intronic
1169758508 20:9067913-9067935 GACCGAACACCATTAGGGCCTGG + Intergenic
1173871245 20:46343509-46343531 TCCCTCACCCCGTCTGGGCCTGG - Intergenic
1173954498 20:47020333-47020355 GCCATCACCCCGTAAGGCCCTGG + Intronic
1178250844 21:31001792-31001814 GACATCTCCGCGTTAGTGCCAGG - Intergenic
1178305259 21:31485870-31485892 GAACTCACCCCCTTCGTGCCTGG - Intronic
1178765456 21:35446568-35446590 GACCTCAACCCTTTATGGCATGG - Intronic
1180574442 22:16759686-16759708 GACCTCAACCCGTGTGGGACAGG - Intergenic
1183541351 22:38431087-38431109 GACCTCACCCGTTGAAGGCCTGG - Intronic
954222261 3:49162074-49162096 CACCTCAACCCCTTTGGGCCTGG + Intergenic
975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG + Intergenic
991466737 5:66921339-66921361 TACCTCACCTCATTAGGTCCAGG - Intronic
1007205464 6:40146495-40146517 CACCTCACCTCATTAGGGTCGGG - Intergenic
1007806794 6:44456377-44456399 GACCACACCCCAAGAGGGCCTGG - Intergenic
1013586212 6:111581265-111581287 CACCTTACCCCCTTTGGGCCTGG - Intronic
1018709226 6:166485878-166485900 GACCTCACCCCCTGAGGGTGGGG - Intronic
1019023149 6:168935839-168935861 GACCACACCGCGGCAGGGCCTGG - Intergenic
1019688265 7:2394680-2394702 GACCGCACCCCCTTGGCGCCCGG - Intergenic
1026896064 7:74010706-74010728 GTCCTCACTCCGGTGGGGCCTGG + Intergenic
1028175877 7:87657666-87657688 GACCCCACCCCAGTATGGCCAGG - Intronic
1029270540 7:99374652-99374674 GACCTCAGCCCGGTAGGGCCCGG - Intronic
1032038391 7:128537275-128537297 AACATCACCGTGTTAGGGCCAGG + Intergenic
1049510400 8:143024303-143024325 CACCGCACCCCGCTAGGACCTGG + Intergenic
1055513482 9:77016527-77016549 GAGCTCACCCAGTGAGGGCCTGG + Intergenic
1061450176 9:130663487-130663509 GACCTGGCCCCGCAAGGGCCGGG + Intergenic
1062524744 9:136973630-136973652 CACCTCACCCATTTAGGGGCTGG - Intergenic
1062582795 9:137235904-137235926 GACCCCACCTCGTTGGGCCCAGG + Intronic
1195865435 X:109427579-109427601 GACCTCAAAACGTTAGGGCTGGG - Intronic
1197014201 X:121604493-121604515 GACCACACATCGGTAGGGCCAGG + Intergenic