ID: 975438364

View in Genome Browser
Species Human (GRCh38)
Location 4:74380737-74380759
Sequence ACAACCTGTAAGGGTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975438364_975438368 28 Left 975438364 4:74380737-74380759 CCTTCTCTACCCTTACAGGTTGT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 975438368 4:74380788-74380810 TCTTCTTTTGTTTAGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975438364 Original CRISPR ACAACCTGTAAGGGTAGAGA AGG (reversed) Intronic
902182706 1:14701619-14701641 AAAAACTGTATTGGTAGAGATGG - Intronic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905418846 1:37825030-37825052 ACGAACTGTAGGGGTAGAGGTGG - Intronic
907101653 1:51843116-51843138 GCAACATGTAAGGATACAGAGGG + Intronic
909638866 1:77849686-77849708 ATAACCTGAAAAGGGAGAGAGGG + Intronic
911838511 1:102651728-102651750 ACAACTTGCAAGGGTTGTGAAGG - Intergenic
912163235 1:107011730-107011752 GCATCCTGTAAGGGCAGAGCAGG + Intergenic
916156580 1:161855618-161855640 TCAACCTGTAATGTTGGAGATGG - Intronic
921677879 1:217996846-217996868 ACAAGCTGTAAGGGAAGAGCTGG + Intergenic
922813224 1:228430019-228430041 ACTCACTGTAAGGGCAGAGATGG + Intergenic
1066469194 10:35681700-35681722 AAAGACTGTAAGGGGAGAGAAGG - Intergenic
1067547614 10:47205754-47205776 AGAACCTGGAAGGGAAGAGGGGG + Intergenic
1072168504 10:92837699-92837721 ATAAGCTATAAGGGTTGAGAGGG + Intronic
1072188258 10:93061734-93061756 ACGTCCTGCAAGGGTAGAAAAGG + Intronic
1072685536 10:97534322-97534344 ACAAGCTGTAAGGGCAGGGCTGG - Intronic
1074139588 10:110660343-110660365 ACAGCCTGGATGGGAAGAGATGG - Intronic
1078981176 11:16536718-16536740 TCAACCTGTAAGGCTACAGCTGG + Intronic
1079455811 11:20635368-20635390 ACATCATGTAAGGGTTAAGAGGG - Intronic
1079772069 11:24474857-24474879 TCAACCTGTAAGAGTAGCTATGG - Intergenic
1083013943 11:59432048-59432070 CCCACATGTAAGGGTATAGAGGG + Intergenic
1083255236 11:61491414-61491436 ACATCCTGTGTGGGAAGAGAAGG + Intergenic
1085653000 11:78285458-78285480 AAAACCTGGAAGTGGAGAGAAGG - Intronic
1085752195 11:79171182-79171204 ACAGCAGGAAAGGGTAGAGAGGG + Intronic
1085832813 11:79919630-79919652 ACAAACTGTGAGGGAAGAAAAGG - Intergenic
1086810500 11:91304192-91304214 AAAACCTGTCAGGGAAGATAAGG - Intergenic
1087441301 11:98186534-98186556 AAAATCAGTAGGGGTAGAGAAGG - Intergenic
1088457027 11:110043636-110043658 ACTACCAATAGGGGTAGAGAGGG + Intergenic
1088716720 11:112555415-112555437 CCCAGCTGAAAGGGTAGAGAGGG - Intergenic
1089082488 11:115788410-115788432 ACTACCTCAAAGGGTAGAGAAGG - Intergenic
1089880381 11:121767809-121767831 ACAGCTTTTAAAGGTAGAGACGG - Intergenic
1089947046 11:122486874-122486896 ACAGGCTGTAAGGCTAGAGAAGG + Intergenic
1090050043 11:123369905-123369927 AAAATCTATAAGGGGAGAGAAGG + Intergenic
1096390591 12:51225784-51225806 ACCACCTGAAAGGGTAAATATGG + Intergenic
1098537707 12:71613431-71613453 ATAACCTGTAAAGGTTGAGGGGG + Exonic
1099351239 12:81571502-81571524 ACAACTTGTAAGTGAAGAGCTGG - Intronic
1101996301 12:109527699-109527721 ACTGCCTGCAAGAGTAGAGAGGG + Intronic
1102925112 12:116820585-116820607 ACAAGCTATGGGGGTAGAGAGGG - Intronic
1106753026 13:32794410-32794432 ACAGCCTGTGAGGGGAGAGTAGG - Intergenic
1106961519 13:35003937-35003959 ACACCCTGTCAGGGTAGGGTGGG - Intronic
1107666389 13:42694740-42694762 TCAACATGTAATGGTGGAGAAGG - Intergenic
1110413744 13:75230082-75230104 AAAAACTGTCAGGGTGGAGAGGG + Intergenic
1110689553 13:78416362-78416384 TCAATATGTAAGTGTAGAGATGG - Intergenic
1113357383 13:109594483-109594505 AGAACCTGAGAGGGTAGAAATGG - Intergenic
1121217473 14:92259645-92259667 ACAACCAGGAATAGTAGAGAGGG - Intergenic
1121850125 14:97214055-97214077 ACAAATTGGAAGGGTGGAGAAGG - Intergenic
1125402042 15:39314403-39314425 AAAACCTGTAAGGAAAGAGTTGG - Intergenic
1126075673 15:44906906-44906928 CCAACCTGTTAGGGTAAAAATGG + Intergenic
1131663074 15:94539391-94539413 ACAAGCTCTAAGGGTGGATAAGG + Intergenic
1132090307 15:98942905-98942927 AAAATCTGTAAGGGAAGAGAGGG - Exonic
1138083908 16:54116538-54116560 ACAACCATAAAGGGGAGAGACGG + Exonic
1139004001 16:62549038-62549060 ACAGCCTGTAAGGGTGGCGAAGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140384857 16:74526981-74527003 TCAACCTGTAAGGGTCATGATGG + Intronic
1144192894 17:12862326-12862348 AAAACGTGCAAGGGTAGAGTTGG - Intronic
1146004321 17:29151338-29151360 ACAATTTGCAAGGGTAGAAATGG - Intronic
1147681925 17:42254725-42254747 ACAAACTGGAAGGGAAGGGAAGG + Intronic
1149072846 17:52563668-52563690 ACAATATGTAAAGGTAGAAATGG - Intergenic
1154064103 18:11090508-11090530 CCAACCTGAAAGGGTAGGGGTGG + Intronic
1154139171 18:11808058-11808080 AAGACCTGTGAGGGTAGAGTAGG - Intronic
1156741435 18:40334736-40334758 ACAACAGGAAAAGGTAGAGATGG - Intergenic
1158098272 18:53800120-53800142 AAAAACTGTAAGGATATAGAAGG - Intergenic
1166076576 19:40417312-40417334 ACATCCTGTGAGGCTAGGGAAGG + Intergenic
1166129778 19:40739339-40739361 ACCACCTGCCGGGGTAGAGACGG - Exonic
1167686837 19:50961876-50961898 ATCACCTGTTAGGGGAGAGATGG + Exonic
927275120 2:21255998-21256020 ACAGCCTGTAAGGATAGTGGAGG + Intergenic
929030445 2:37645898-37645920 GGAACCTGTAAGGTCAGAGAGGG + Exonic
930895266 2:56439145-56439167 ACAGCTTGTATGGCTAGAGAAGG + Intergenic
931485616 2:62688211-62688233 ACAAACTGTAAGGAAGGAGATGG - Intronic
933570882 2:84010244-84010266 ACAACCTGAAGGAGGAGAGAGGG + Intergenic
943046671 2:182868156-182868178 ATAAGCTGAAAGGGTAGAGTGGG - Intergenic
944020426 2:195096574-195096596 ACAGACTGAAAGGGAAGAGATGG + Intergenic
944364608 2:198902992-198903014 CCAACATGTAAGAGTAGAGGGGG - Intergenic
946753164 2:222914189-222914211 ACCACCTGTAAGTAGAGAGAAGG + Intronic
947758525 2:232586907-232586929 TCACCATGTAAGGGCAGAGATGG + Intergenic
947916342 2:233834242-233834264 AGAACATGTAGGGGAAGAGAGGG + Intronic
1170522136 20:17197623-17197645 ACCACCTGTTAGGGAAGAAAAGG - Intergenic
1176102490 20:63370843-63370865 AGAAGCTGTGAGGGTAGAGAAGG - Intronic
1177922177 21:27165651-27165673 ACAACCCATAAGGGAAAAGATGG - Intergenic
1182148872 22:28014537-28014559 ATTACCTGAAAGGGAAGAGAAGG - Intronic
1183044261 22:35207233-35207255 ACAACCTTCAAGGGTTGTGATGG - Intergenic
1183306225 22:37084577-37084599 ACATCCTGCCAGGGTGGAGAGGG - Intronic
949750863 3:7351276-7351298 ACAGCCTGAAAGTGGAGAGAGGG - Intronic
950359888 3:12442682-12442704 ACAGCCTGAAAGGGGAGAAAAGG + Intergenic
950828860 3:15854693-15854715 AAGATCTGTAAGGGTAGAGATGG + Intronic
954803733 3:53202873-53202895 ACAACCTGTCTGGGGAGAGAGGG + Intergenic
955616209 3:60809716-60809738 ACAACCTTTAAGGTTTCAGAAGG - Intronic
956902204 3:73728666-73728688 ACATCCTCTAAGGGTAGCTAAGG + Intergenic
957422082 3:79983595-79983617 ACATACTGTAAAGATAGAGAGGG + Intergenic
957998273 3:87718889-87718911 ACAAACTGTAAGTGAAGAGAAGG + Intergenic
958841377 3:99209441-99209463 ACAACCTGTGAGGGCAGCCACGG - Intergenic
963601950 3:147386295-147386317 ACAAACAGTGTGGGTAGAGAGGG + Exonic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
967454275 3:189664384-189664406 ACAAACTTTAAAGCTAGAGATGG + Intronic
969940197 4:10724399-10724421 ACAACAGGAAAAGGTAGAGAAGG - Intergenic
970338307 4:15076859-15076881 ACAAACTGAAAGTGAAGAGATGG + Intergenic
971611815 4:28735324-28735346 ACAACTTGTAAGGGATGTGAAGG - Intergenic
972072114 4:35034300-35034322 ATAACCTGTAAGTGAAGGGATGG + Intergenic
972459653 4:39289264-39289286 ACCACCTGTTAGGGTCGACATGG + Intronic
975438364 4:74380737-74380759 ACAACCTGTAAGGGTAGAGAAGG - Intronic
976055966 4:81067464-81067486 ACAACATTCAAGAGTAGAGAAGG + Intergenic
976819405 4:89188081-89188103 ACAACCTACAAGGGAAGTGAAGG - Intergenic
977625350 4:99183891-99183913 ACAACTTGTAAGGGAGGTGAAGG - Intergenic
981276668 4:142907085-142907107 ACAAACTGAAAGTGTAGAAATGG - Intergenic
984370131 4:178853130-178853152 AAAACCTGGGAGGGCAGAGAGGG + Intergenic
985141613 4:186845725-186845747 AAAACCTGTTAGAGAAGAGAAGG + Intergenic
985804691 5:2033955-2033977 AGAAGGTCTAAGGGTAGAGAAGG - Intergenic
985960654 5:3300923-3300945 ACAACCGGTAAGTGATGAGAAGG + Intergenic
987084817 5:14458480-14458502 AAACCCTGTTAGGGTTGAGAAGG - Intronic
988109175 5:26794065-26794087 AGAAACTGAAAGTGTAGAGATGG - Intergenic
988338592 5:29938775-29938797 ACAGCCTGTAGGAGTTGAGAGGG + Intergenic
989315004 5:40068314-40068336 ACACCAGGTAAGAGTAGAGAGGG - Intergenic
991080588 5:62594782-62594804 ACAACCTAGAAGGGGAGACAGGG + Intronic
991500340 5:67270052-67270074 AAAACCTGTAAGGAAAGATATGG - Intergenic
991544308 5:67764808-67764830 AGAACGTGTAGGGATAGAGATGG + Intergenic
993089397 5:83405867-83405889 AGAGCCAGCAAGGGTAGAGAGGG - Intergenic
994289682 5:98014305-98014327 ACAAAATATAAGGGTAGATATGG - Intergenic
994910606 5:105900943-105900965 AGACCCTGTAAGAGTTGAGAAGG + Intergenic
999131478 5:149286845-149286867 ACAACCAGTAAGTGTGGAGCTGG + Intronic
999702844 5:154244106-154244128 GCAACCTGCAAGGGATGAGAAGG + Intronic
1000261241 5:159590723-159590745 CCATCCGGAAAGGGTAGAGAAGG - Intergenic
1004285000 6:14313527-14313549 TCAACCTCTTAGGGCAGAGAAGG - Intergenic
1005191414 6:23228411-23228433 ACTACCAGGGAGGGTAGAGAAGG + Intergenic
1005829403 6:29658569-29658591 AAAACCTCTAAGGGTAGAATAGG + Intronic
1006843573 6:37047648-37047670 AGAACCTCTAGGGTTAGAGATGG - Intergenic
1006877094 6:37307056-37307078 CAAACCTGTAAGTGTAGAGAGGG - Intronic
1016664404 6:146619231-146619253 ACATACTGAAAGTGTAGAGATGG - Intronic
1017042262 6:150317103-150317125 ATCACCTGTGAGGGTGGAGAGGG - Intergenic
1018147222 6:160902818-160902840 ACAATCAGTAAGGATACAGAAGG - Intergenic
1020876485 7:13701348-13701370 GCAACCTGGAAGAGCAGAGAGGG + Intergenic
1021530881 7:21643263-21643285 ACAACCTGAAAGGGTGCAAAAGG - Intronic
1022663062 7:32384620-32384642 ACAACCTGCATGGGTACACAGGG + Intergenic
1023324993 7:39044647-39044669 ACAACCTGTAAGAACAGAAATGG - Intronic
1023600280 7:41875625-41875647 CCAACCTGTCAGGGCAGACACGG + Intergenic
1024509294 7:50190540-50190562 ACACACTGTTAGCGTAGAGAAGG - Intergenic
1025855597 7:65274857-65274879 ACAAGCTGTAAGTGAAAAGATGG - Intergenic
1027541691 7:79475028-79475050 AAGATCTGTAAGTGTAGAGATGG + Intergenic
1029953823 7:104615919-104615941 ACAACCTGCAAGGGATGTGAAGG + Intronic
1037396713 8:18451200-18451222 ACTACGTGTAATGGTAGAGGGGG + Intergenic
1038416459 8:27399832-27399854 ACAACCAGTAAGGATGGAGCAGG - Intronic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1044941654 8:97349673-97349695 ACTACCTGTCAGAGAAGAGAGGG - Intergenic
1046661899 8:116957067-116957089 AGACCCTGTCAGGGTACAGATGG + Intronic
1047807095 8:128371921-128371943 GACACCTGTAAGGGCAGAGAGGG + Intergenic
1049436887 8:142590519-142590541 ACATCCTGGAAGGGTGGCGATGG - Intergenic
1051475810 9:17507961-17507983 ACAAAATGTAAGAGTACAGAAGG - Intergenic
1056015355 9:82380298-82380320 ACAGCCTGCAAGGGAAGTGAAGG + Intergenic
1061414324 9:130438195-130438217 ACAGCCTGGAGGGGAAGAGAAGG + Intergenic
1061574916 9:131500331-131500353 AGAAGCTGTGTGGGTAGAGAAGG + Intergenic
1061863928 9:133482368-133482390 TCAAACTGTAAGGGTAGAAAAGG + Intergenic
1062082213 9:134630093-134630115 ACAACCTCGAAGGCTAGAGACGG + Intergenic
1185521979 X:747270-747292 TCAAGCTGTAATGGGAGAGATGG + Intergenic
1187545954 X:20252751-20252773 ACAACAGGGGAGGGTAGAGAAGG + Intronic
1189297184 X:39927127-39927149 GCAGCCTGTAGGGGTGGAGACGG - Intergenic
1189827350 X:44933233-44933255 ATAAACTGTGAGGGAAGAGAAGG - Intronic
1190927737 X:54923812-54923834 ACAAACTAGAAGGGTAGAAATGG - Intronic
1192078559 X:68024873-68024895 ACAACCTGTAAAGCTTGGGAAGG + Intergenic
1195778755 X:108437989-108438011 ACAACCTGAAATGGGAGGGAGGG + Exonic
1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG + Intronic
1199101163 X:143801998-143802020 AGAACCTAAAAGGGTAGAAAAGG + Intergenic
1200813766 Y:7510650-7510672 CCAACTTGTAAGGGTTGGGAAGG - Intergenic
1201537302 Y:15064807-15064829 ACAACCTGCAAGGGATGTGAAGG - Intergenic
1201597621 Y:15689557-15689579 ACATTCTATAAGGGTAGAGCAGG + Intergenic