ID: 975441767

View in Genome Browser
Species Human (GRCh38)
Location 4:74419470-74419492
Sequence CATGAACCTGGTTCTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975441765_975441767 -4 Left 975441765 4:74419451-74419473 CCAAGTCTCTTCTGGGACACATG No data
Right 975441767 4:74419470-74419492 CATGAACCTGGTTCTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975441767 Original CRISPR CATGAACCTGGTTCTCCTTG TGG Intergenic
No off target data available for this crispr