ID: 975444379

View in Genome Browser
Species Human (GRCh38)
Location 4:74445354-74445376
Sequence CCCGCTGCTACCGCCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975444374_975444379 1 Left 975444374 4:74445330-74445352 CCGCTGCGAAGGACCAATGAGAG 0: 1
1: 0
2: 0
3: 8
4: 80
Right 975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 17
4: 171
975444367_975444379 29 Left 975444367 4:74445302-74445324 CCGAGTTGCCCCAGAGACCGAGA 0: 1
1: 0
2: 0
3: 17
4: 196
Right 975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 17
4: 171
975444369_975444379 20 Left 975444369 4:74445311-74445333 CCCAGAGACCGAGACGCCGCCGC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 17
4: 171
975444368_975444379 21 Left 975444368 4:74445310-74445332 CCCCAGAGACCGAGACGCCGCCG 0: 1
1: 0
2: 0
3: 4
4: 58
Right 975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 17
4: 171
975444370_975444379 19 Left 975444370 4:74445312-74445334 CCAGAGACCGAGACGCCGCCGCT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 17
4: 171
975444373_975444379 4 Left 975444373 4:74445327-74445349 CCGCCGCTGCGAAGGACCAATGA 0: 1
1: 0
2: 0
3: 1
4: 52
Right 975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 17
4: 171
975444371_975444379 12 Left 975444371 4:74445319-74445341 CCGAGACGCCGCCGCTGCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975444379 Original CRISPR CCCGCTGCTACCGCCGGCGC CGG Exonic
900299760 1:1970672-1970694 CCAGCTCCTGGCGCCGGCGCTGG + Exonic
900408449 1:2502527-2502549 CCCGGTGTTCACGCCGGCGCAGG - Intronic
901441387 1:9280441-9280463 CCCGCTGCCAGCGGCGGGGCGGG - Intergenic
901631589 1:10650850-10650872 CCCGCTGCAACTGCCTGGGCGGG + Intronic
902148162 1:14420765-14420787 CCGGCTGGTGCCGCCGGCCCCGG - Intergenic
904517230 1:31065761-31065783 GCCGCTGCCACCGCCGGGGCCGG - Intronic
905546454 1:38804101-38804123 CCCGCTGTGGCCGCTGGCGCCGG + Intergenic
910237338 1:85048754-85048776 TCCGGAGCTGCCGCCGGCGCCGG + Intronic
914244044 1:145872806-145872828 CCCGCTGCAGCCGCTGGCTCAGG + Exonic
915070480 1:153261638-153261660 TCCGCCGCTGCCGCCGCCGCCGG - Exonic
918282959 1:183023576-183023598 GCCGCCGCCACCGCCCGCGCCGG + Exonic
918365653 1:183805139-183805161 CGCGCTGCCCCCGCCGCCGCCGG - Intronic
921110885 1:212035591-212035613 GCCTCTGCTACCCCCTGCGCAGG + Exonic
924042605 1:239998051-239998073 CCCGCGGCCACCGCCGACCCGGG + Intergenic
924568447 1:245217436-245217458 CCCGCTGCAACCTCCGCTGCTGG + Intronic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1065019995 10:21495880-21495902 CCCGCTGCACGCGGCGGCGCGGG - Exonic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1069673939 10:70233600-70233622 CACGTGGCTGCCGCCGGCGCTGG + Intronic
1071086644 10:81874603-81874625 CGCGCCGCTGCCGCCGCCGCCGG - Intergenic
1071695356 10:87863795-87863817 GCCGCCGCTGCCGCCGCCGCAGG - Exonic
1072059737 10:91798468-91798490 CGCGCTGCCTCCGCCGCCGCGGG + Exonic
1072070279 10:91908752-91908774 CCCGCTGCGGCCTCCGGGGCGGG + Exonic
1073051656 10:100671120-100671142 CCCGCCGCCTCCGCCGGGGCCGG + Intergenic
1073325978 10:102644170-102644192 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1074466962 10:113692024-113692046 CCCACTGCTACCACCGCAGCTGG - Exonic
1075334206 10:121597382-121597404 CCCGCAGCCGCCGTCGGCGCTGG - Intronic
1076279786 10:129236629-129236651 GCCGCCGCTTCCTCCGGCGCTGG - Intergenic
1077956003 11:7020482-7020504 CCCGCAGCTCCCGCCCGCGCAGG - Exonic
1079035032 11:17013886-17013908 TCCTCTGCTCCCGCCGGCCCGGG - Intronic
1081700146 11:45147365-45147387 CCCGCAGCAGCCCCCGGCGCGGG - Exonic
1083807495 11:65083833-65083855 CCCGCTGCCGCCGCCGGAGGAGG - Intronic
1084793554 11:71489952-71489974 CCCGCTGCCAACGCTGGTGCAGG - Intronic
1086455365 11:86955088-86955110 GCCGCTGCTACCCCCGATGCTGG - Exonic
1089243089 11:117098319-117098341 CCTGCTGCCTCCGCCCGCGCCGG - Exonic
1094041036 12:26122316-26122338 GCCGCGGCTGCCGCCGGGGCGGG + Exonic
1094041122 12:26122642-26122664 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1105578840 13:21675327-21675349 CCCGCTGCTGCCGCTGCGGCAGG + Intronic
1105871157 13:24507069-24507091 CCCGCTGGCCCCGCCGGCCCCGG - Intronic
1106057713 13:26254268-26254290 CCCGCCGCTCCCGCCGCAGCAGG + Exonic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1112507813 13:99985446-99985468 GCCGCCGCTGCCGCCGCCGCTGG - Exonic
1113492865 13:110706036-110706058 CCCGCTGCTCCAGGCCGCGCTGG - Exonic
1113902051 13:113802899-113802921 CCCGCTCCCACCGCAGGGGCCGG - Intronic
1114031266 14:18583152-18583174 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1114037928 14:18646560-18646582 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1114120693 14:19668471-19668493 ACCGCTGCGGCCGCCGCCGCTGG - Intergenic
1114559629 14:23580694-23580716 CCAGCTGGCCCCGCCGGCGCTGG + Intergenic
1117183664 14:53217773-53217795 CCCGCCGGCACCGCCGGCCCGGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118967375 14:70600688-70600710 CCCGCTGCTTCCGGCGGCCTAGG - Intronic
1119451261 14:74712932-74712954 CGCGCTGCAACCCCCGGCTCGGG - Exonic
1119695057 14:76706927-76706949 CCGGCTGGTGCCGCCTGCGCGGG - Intergenic
1121127699 14:91418264-91418286 CCCGCAGCTGCCGCCCGCTCTGG + Intergenic
1122788378 14:104174276-104174298 CCCGCATCCACCGCCTGCGCAGG + Exonic
1123671603 15:22664666-22664688 CCCACGGCTGCCGCCGGAGCTGG + Intergenic
1124323642 15:28737891-28737913 CCCACGGCTGCCGCCGGAGCTGG + Intronic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125594261 15:40874142-40874164 CCCTCTGCTGCCCCCGGAGCGGG - Exonic
1129108065 15:73322712-73322734 CCCGCTGCCACCCCCAGCCCTGG + Exonic
1130261138 15:82355269-82355291 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130280097 15:82513749-82513771 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130317651 15:82810041-82810063 CCCGCGGCTGCCGCCGGAGCTGG + Exonic
1130471472 15:84229935-84229957 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130478966 15:84344506-84344528 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130492804 15:84443625-84443647 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130593766 15:85234562-85234584 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1132365104 15:101251510-101251532 CCCGCTGCCCCCGCCCGCGGAGG + Exonic
1132490710 16:229131-229153 CGCGCTCCGACCGCAGGCGCCGG - Intronic
1133201736 16:4207897-4207919 CCCGCGTCTGCCGCCAGCGCGGG - Intronic
1134065277 16:11224467-11224489 ACAGCTGCCACCGCCGGCCCTGG + Intergenic
1134136444 16:11679542-11679564 CCCGCTGCTGCTGCCGCAGCCGG + Exonic
1134849860 16:17470862-17470884 CCCGCAGCTCCCGCGGCCGCCGG + Exonic
1135712551 16:24729911-24729933 GCCTCTGCTGCCGCCGCCGCGGG - Intronic
1136247138 16:28982514-28982536 CACGATGCTACCACGGGCGCAGG - Exonic
1136572623 16:31105802-31105824 CTCGCTGCTGCCCCCGGCGGCGG - Intergenic
1140123264 16:72101073-72101095 CCCACTGCTGCAGCCGGAGCCGG + Exonic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1142130749 16:88430535-88430557 CCCGCAGCTCCCGGCGCCGCCGG + Exonic
1143099882 17:4499122-4499144 CTCGCTGCGCCCCCCGGCGCCGG - Exonic
1143150774 17:4806878-4806900 CACGCTGGGACCGACGGCGCGGG + Intergenic
1144909914 17:18672512-18672534 ACCGCTGCCACCGCCGCAGCCGG - Intronic
1145912886 17:28552599-28552621 CCCCCGGCTCCAGCCGGCGCAGG - Exonic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1146165379 17:30584273-30584295 CCCGCTGCTTCTGGCGGCACAGG - Intergenic
1146581160 17:34040016-34040038 CGGGCAGCCACCGCCGGCGCCGG + Intronic
1147192739 17:38747352-38747374 CCCCCTGCTTCCGCTGGCGATGG + Intronic
1152868005 17:82735695-82735717 CTCGCTGATGCAGCCGGCGCCGG - Exonic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1155003305 18:21706615-21706637 CCGGCTGGCACCGCCGGCCCTGG + Intronic
1158643171 18:59220283-59220305 CCCGCTGGTCCTGCTGGCGCTGG + Exonic
1159770502 18:72542196-72542218 CGCGCCGCTCGCGCCGGCGCCGG - Exonic
1160025030 18:75209539-75209561 CCCGGGGCTGCCGCCGGCTCGGG - Intergenic
1161388092 19:4007612-4007634 CGCGCTGCTGCCTCCTGCGCAGG - Intergenic
1161400708 19:4065464-4065486 GCCGCCGCCACCGCCGCCGCCGG - Intronic
1161668983 19:5594060-5594082 CCCGCTCCAGCCGCTGGCGCTGG + Exonic
1161677673 19:5661617-5661639 CCCGCTCCAGCCGCTGGCGCTGG - Exonic
1161911551 19:7198183-7198205 GCCGCCGCAACCGCCGGGGCCGG - Intronic
1162128519 19:8511851-8511873 CCCGCCGCCACCCCCGGCCCTGG - Exonic
1164759723 19:30719777-30719799 CCCGCTGCGGCCTCCGGCTCTGG + Intergenic
1164952170 19:32345811-32345833 CCCGCTGTTAGCGCCGCCGCCGG + Intronic
1165233842 19:34404782-34404804 GCCGGTGCTACAGCCGGGGCAGG - Exonic
1168280887 19:55304816-55304838 CCCGACGCCACCGCCGGGGCTGG - Exonic
1168721770 19:58558394-58558416 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
925912704 2:8583766-8583788 CCTGCTGCAGGCGCCGGCGCGGG - Intergenic
929188786 2:39120983-39121005 GCCGCCGCCACCGCCGCCGCCGG + Exonic
930762377 2:55050324-55050346 GCAGCTGCTGCCGCCGCCGCCGG + Exonic
934517247 2:94996438-94996460 AGCGCTGCTACCGCCAGCTCCGG - Intergenic
941029314 2:160493444-160493466 GCCGCCGCTGCCGCCGCCGCCGG - Exonic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941951518 2:171160952-171160974 GCCGCCGCTACCGGAGGCGCAGG - Intronic
942620010 2:177835771-177835793 CCAGCTGGTGCCGCCGGCCCTGG + Intronic
946404106 2:219483670-219483692 CCCGCAGCAGCCGCTGGCGCAGG - Exonic
948473788 2:238203623-238203645 CCCGCTGCTGCCGCCCGCCCGGG - Exonic
1168800534 20:641801-641823 CCCGCTGCTTCCGCAGGGACAGG + Intergenic
1176283383 20:64327998-64328020 CCCGCCGCCACCCCAGGCGCAGG - Intergenic
1178992236 21:37366285-37366307 CCCGCCCCTCCCCCCGGCGCGGG + Intronic
1179563947 21:42234865-42234887 TCCGCCGCCACCGCCCGCGCCGG + Intronic
1180064340 21:45405140-45405162 CGCGCTGCAGCCGCCGCCGCTGG - Intronic
1180455379 22:15510210-15510232 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1180462055 22:15573602-15573624 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1180733887 22:18001473-18001495 CCGGCTGCTACCTACCGCGCCGG - Intronic
1181831716 22:25565157-25565179 CCAGCTGCCCCGGCCGGCGCCGG + Intronic
1182437504 22:30340244-30340266 CCCGCTGCTCCAGCCAGCGAGGG + Exonic
1182771862 22:32801978-32802000 GCCGCTGCTGCCGCCGCTGCCGG - Exonic
1183588945 22:38769000-38769022 CTCGCTGCAGCCGGCGGCGCAGG - Intronic
1184033989 22:41910076-41910098 CCCGCGGCAACCCCCGGCGCGGG - Exonic
1185037959 22:48489557-48489579 CGCGCTGCTGCCCCCCGCGCGGG + Exonic
1185268769 22:49918814-49918836 GCTGCTGCTGCCGCCCGCGCCGG + Exonic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
954265947 3:49470411-49470433 CGCGGTCCTCCCGCCGGCGCTGG + Exonic
954540714 3:51391569-51391591 CCCGCCGCTTCCGCTGCCGCGGG - Exonic
954540880 3:51392267-51392289 GCCGCTGCTGCCGCCGCCGTGGG + Exonic
962859825 3:139389427-139389449 CCCGCTGCGGCCGCCGCCTCAGG - Intronic
964771194 3:160225701-160225723 GCTGCTGCTACTGCTGGCGCTGG + Exonic
968479066 4:825931-825953 CCCGCTTCTCCCGCCGGCCCCGG - Intronic
968583173 4:1404273-1404295 CCCCCAATTACCGCCGGCGCAGG + Intronic
969475908 4:7422368-7422390 CCCGCTTCTACAGCCTGGGCAGG + Intronic
969746779 4:9078955-9078977 CCAGCTGCTGCTGCCGCCGCCGG + Intergenic
970194633 4:13542431-13542453 CCCGCTGCCGCCCCCGCCGCCGG + Exonic
971195759 4:24471031-24471053 CCCGCCGCGCTCGCCGGCGCTGG - Intergenic
972312072 4:37891129-37891151 CCTGTTGCTGCCGCCGCCGCGGG + Exonic
975444379 4:74445354-74445376 CCCGCTGCTACCGCCGGCGCCGG + Exonic
976246767 4:83012708-83012730 CCCGCTGCGAGTGCCTGCGCGGG - Intronic
978384461 4:108166904-108166926 CCAGCTGCTAGCCCAGGCGCTGG + Intronic
981093486 4:140756355-140756377 CCCGCTCCTCCCGCCGCCGTGGG - Intergenic
983077494 4:163343908-163343930 CCCGCTGCTGCCGCCACCGCCGG + Intronic
984928522 4:184826565-184826587 CCCGCAGCTCGCGCCGGTGCAGG + Exonic
990545296 5:56815850-56815872 CCCGCTGCGTCCGCGGGCTCCGG - Exonic
992950352 5:81851909-81851931 ACGGCTCCTACCACCGGCGCTGG - Intergenic
996862880 5:128084514-128084536 CCCACTGCCGCCGCCGCCGCCGG - Exonic
997521538 5:134526880-134526902 CCCGCCGCTCCGGCCGCCGCCGG - Intronic
999248391 5:150167301-150167323 ACCGCTGCCACCGCCGCCTCCGG - Exonic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1007409387 6:41653217-41653239 CCTGCTGCTGCCGCTGCCGCAGG + Intronic
1007553350 6:42746583-42746605 GCTGCTGCTTCCTCCGGCGCGGG - Intergenic
1011643057 6:89433159-89433181 CCCGCCGCGTCCGCCGCCGCAGG - Intronic
1012829543 6:104187446-104187468 CCCACTGCTACCACTGGAGCGGG + Intergenic
1013106144 6:107028176-107028198 CCCGCCCCTTCCGCCGGCGCCGG - Intergenic
1013273400 6:108561601-108561623 ACCGCTGCCACCGCCGCAGCCGG + Exonic
1015251828 6:131135526-131135548 GCCGCTGCTGCCGCTGCCGCGGG + Intergenic
1015773470 6:136792004-136792026 CCAGCTGCCACCGCCGCCGCCGG - Exonic
1015910107 6:138161628-138161650 CCCGCGGCCACCGTCGGCTCAGG + Intergenic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1023618480 7:42045419-42045441 TCAGCTGCCACCGCCGGCACGGG - Exonic
1029456669 7:100675337-100675359 GCCGCTGCTCCCTCCAGCGCAGG - Intronic
1033135285 7:138778945-138778967 TCTGCTGCTACCACCGGGGCTGG - Intronic
1034560457 7:151876555-151876577 GCCGCCGCTCCCGCCGGGGCTGG + Exonic
1037887906 8:22604767-22604789 GCCGCTGCTGCCGCCGCCACCGG - Exonic
1038883652 8:31640248-31640270 CCCCCTGCTGCCGCCGCTGCGGG - Intronic
1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG + Exonic
1040928876 8:52714090-52714112 TCTGCTGCTGCCGCCGGCGAAGG - Exonic
1041552680 8:59119259-59119281 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1051774772 9:20621842-20621864 CCCGCAGCTCCCGGCGGCGGCGG + Intronic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1059633955 9:116154394-116154416 CCCGCTGCTGCCGCCGCCGGGGG - Exonic
1060514582 9:124257940-124257962 GCCGCCGCCACCGCCTGCGCGGG - Intronic
1061029005 9:128068423-128068445 CCCGCAGATAGCGCCGCCGCAGG - Exonic
1061141843 9:128771987-128772009 CCCGCGGCTAACGCGGGCGGCGG + Intronic
1061283674 9:129610724-129610746 CGCGGTGCTGCAGCCGGCGCAGG + Intronic
1061840849 9:133357780-133357802 CTCGCTGGTACCGCCGGCCCTGG - Exonic
1187403675 X:18984209-18984231 CCCGCTGCTCCCGCGAGCGTCGG - Exonic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1200239584 X:154486673-154486695 CTCGCTGCTTCCGGCGGCGGCGG - Intergenic
1200244618 X:154516319-154516341 CCCGCCTCTACCGCTCGCGCTGG + Intergenic