ID: 975445000

View in Genome Browser
Species Human (GRCh38)
Location 4:74453252-74453274
Sequence GTGCTTGCACTGATAATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975445000 Original CRISPR GTGCTTGCACTGATAATGTG AGG Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
904587453 1:31588133-31588155 GTGCTGGCACTGGGAATCTGAGG - Intergenic
907512375 1:54971262-54971284 ATATTTGCACTTATAATGTGAGG - Intergenic
908568451 1:65383461-65383483 GTGCCTGCACTTGTAATGTCTGG + Intronic
910065998 1:83151430-83151452 GTGCTTCCAGTGAAAATGTGAGG - Intergenic
910802838 1:91162647-91162669 GTGCCTGCACTGAGGATGTATGG - Intergenic
914755605 1:150560054-150560076 GTCCTTGCATTGATCATCTGGGG - Exonic
917451151 1:175148443-175148465 CTGCTCGCTCTGATAATGAGTGG + Intergenic
920161839 1:204004569-204004591 GTGCTTACTCAGAGAATGTGAGG + Intergenic
924192511 1:241568738-241568760 GTGCTTTCAGGGATTATGTGGGG - Intronic
1066691189 10:38030344-38030366 GTTCTTGAATGGATAATGTGTGG + Intronic
1075297228 10:121288425-121288447 GTGCTTGCCCAGATATAGTGGGG + Intergenic
1075797157 10:125128705-125128727 ATGCTTCCACTGATCATGTATGG - Intronic
1078731423 11:13978575-13978597 TAGCTTGCACTGATACTTTGAGG + Intronic
1080730485 11:34946739-34946761 GTTCTTCTACTCATAATGTGAGG - Intronic
1080828735 11:35871496-35871518 GTGTTTGGACTGAGAATTTGGGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1087923695 11:103895565-103895587 TTGCATGCACTGATATTTTGTGG - Intergenic
1088618114 11:111653737-111653759 GTGCTGGCACTGAAAATGGATGG - Intronic
1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG + Intergenic
1092940296 12:13401830-13401852 GTGTCTGCACTTATAAAGTGGGG - Intergenic
1093714756 12:22368473-22368495 GTTCTTTCACTGTTATTGTGTGG - Intronic
1096845281 12:54403202-54403224 GCTCTTGCTCTGATAATGTAGGG + Exonic
1103086636 12:118066516-118066538 GGGCTTGCACTAACAATGTTTGG - Exonic
1105602836 13:21902383-21902405 CTGCTTGCACGGGTAATGTGAGG - Intergenic
1105835620 13:24208638-24208660 GTGCATGAACTGAGAATGTCTGG - Intronic
1105883856 13:24625960-24625982 GTGCTTGCACTGGCACTGTGGGG - Intergenic
1107811139 13:44200804-44200826 GTGATTTCACTGAAGATGTGGGG + Intergenic
1108002181 13:45914373-45914395 GTACTAGCAATGATAGTGTGAGG + Intergenic
1109039533 13:57314876-57314898 GTGCTTGTACTGCTTATCTGTGG - Intergenic
1112674308 13:101680941-101680963 GTTCTGGCAAAGATAATGTGGGG - Intronic
1118842441 14:69523355-69523377 GGGCTATCACTGATCATGTGTGG - Intronic
1121814958 14:96922070-96922092 GTGCCTGAACTGATTATGTTTGG - Intronic
1126230913 15:46323060-46323082 GTGTCTGCCCTGACAATGTGAGG - Intergenic
1126232755 15:46345916-46345938 GTGGTTGCACTGTGAATGTGAGG - Intergenic
1128034586 15:64513368-64513390 GTGCTTGGATTGAGAATGTAGGG + Intronic
1137020434 16:35420218-35420240 TTGCCTTCACTGGTAATGTGAGG - Intergenic
1139110382 16:63883343-63883365 GTGATTGCACTGAGCATGTTAGG + Intergenic
1142124622 16:88403985-88404007 GTGTTTGCACTGTCAGTGTGAGG - Intergenic
1144457821 17:15433286-15433308 TATCTGGCACTGATAATGTGTGG + Intergenic
1149456691 17:56793951-56793973 GAGCTTTCACAGATAATGAGAGG - Intronic
1153719451 18:7886985-7887007 GTGTGTTTACTGATAATGTGTGG + Intronic
1163128237 19:15255997-15256019 GGGCTTGCTCTGAGACTGTGTGG - Intronic
1164808630 19:31138618-31138640 GTGCTCGCAGGGAGAATGTGAGG - Intergenic
1168535398 19:57164896-57164918 GTTCTTGCACTGAAAGTATGAGG + Intronic
927049714 2:19314959-19314981 GGCCTTGCACTGCTAATGTCTGG - Intergenic
927326013 2:21806196-21806218 GTGCTTGCTCTGCTATTGTTGGG + Intergenic
932053085 2:68418412-68418434 TAGCTTGCACTGTTGATGTGAGG + Intergenic
932948935 2:76270312-76270334 CTGCTTGCACTCATAGTGGGAGG - Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934609728 2:95726076-95726098 GTTCTTGCAATGATTCTGTGGGG - Intergenic
936543047 2:113367646-113367668 GTTCTTGCAATGATTCTGTGGGG - Intergenic
936852847 2:116921794-116921816 GAGCTTGCATTGATTAGGTGTGG - Intergenic
937013223 2:118580507-118580529 GTCATTGCACTGAGGATGTGGGG + Intergenic
945169972 2:206985587-206985609 ATGCATGCCCTGAAAATGTGGGG - Intergenic
945491467 2:210460774-210460796 GTGCTTTCACAGATGATCTGGGG + Intronic
946905764 2:224414583-224414605 GGGCATGCACTGGGAATGTGGGG - Intergenic
1170127638 20:12983578-12983600 GTGCTTTCACTGAAAATTTGGGG + Intergenic
1173274739 20:41569974-41569996 GTGCTTGGACTGATGATGGAAGG - Intronic
1175285160 20:57833019-57833041 GTGATTGAACTGAGAATATGAGG + Intergenic
1181525672 22:23484339-23484361 GTGTTTGCAGTCATCATGTGAGG + Intergenic
1185062270 22:48613241-48613263 GTCCTTTCACTGATGATCTGAGG + Intronic
956888580 3:73586488-73586510 GTGCTAGTACTGAGAATATGCGG + Intronic
959411798 3:106033069-106033091 GTGTTTTCACTTAGAATGTGAGG - Intergenic
966046977 3:175564060-175564082 CTGCTTGAAATGGTAATGTGTGG + Intronic
967768935 3:193312897-193312919 TTGCTTGCACTGGGAATGTGGGG + Intronic
968981755 4:3853923-3853945 GTGCTGGCACTGGGCATGTGCGG - Intergenic
970982631 4:22118851-22118873 TTGCATGCACTGATAAGTTGTGG - Intergenic
974232756 4:59137842-59137864 GTGCTTGCGGTCATATTGTGGGG - Intergenic
975445000 4:74453252-74453274 GTGCTTGCACTGATAATGTGAGG + Intronic
978219915 4:106257439-106257461 GTACTAGCAATGATAGTGTGAGG - Intronic
981769362 4:148289799-148289821 TTGCTTGCTCTGATAATGCGAGG + Intronic
988203500 5:28100600-28100622 GTGTTTGCACTGATATTATTGGG + Intergenic
992333634 5:75742786-75742808 GTTGTTGCACTGGTAATGTAAGG + Intergenic
997528214 5:134566960-134566982 GAGCTTGCATTGAGAATCTGAGG + Intronic
999799721 5:155021880-155021902 GTGCTATCACTGATCATGTGAGG + Intergenic
1000983623 5:167843270-167843292 ATGCTTGCTCTGAGAATTTGAGG + Intronic
1004474507 6:15958940-15958962 GTGCTTGCTCTGATTGTTTGGGG + Intergenic
1011847090 6:91579283-91579305 GTGCTTGCTTTGAAAATGTTAGG + Intergenic
1012420685 6:99061675-99061697 TTGCTTGAACTGAGAATCTGAGG - Intergenic
1015897501 6:138031454-138031476 GTATTTGGTCTGATAATGTGAGG + Intergenic
1019734561 7:2644395-2644417 GTGCTGGGACTGTTAATATGAGG + Intronic
1021422160 7:20457841-20457863 GTGTTTGCACAGAAAATATGTGG + Intergenic
1021963050 7:25891744-25891766 GTCCTTCCACTGAGAATCTGTGG + Intergenic
1024339435 7:48242364-48242386 TTCCTGGCACTGAGAATGTGTGG - Intronic
1027278111 7:76583345-76583367 GTGCTTCCAGTGAAAATGTGAGG + Intergenic
1027492780 7:78850771-78850793 GTGCTTTGGCTGATAATTTGGGG - Intronic
1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG + Intergenic
1049763719 8:144343234-144343256 GTGCTTGCAGTGCTTAGGTGGGG - Intergenic
1051558713 9:18414825-18414847 GTTCTTTTACTGATAATGTGTGG - Intergenic
1061358763 9:130126864-130126886 TTGCATGCAGTGATAATGAGTGG + Intronic
1186207925 X:7219435-7219457 GTGCTTGGGCAGATAATGTGAGG - Exonic
1186871531 X:13778632-13778654 CTGGTTTCACTGATAATTTGGGG - Intronic
1192738871 X:73874553-73874575 GTGCCTGCAATGTTAAGGTGGGG - Intergenic
1194971547 X:100349391-100349413 GTGCTTTCACTGATAATACAAGG + Intronic
1195077765 X:101343797-101343819 GTGTGTGCACTGATTATGTGGGG - Intergenic
1197822612 X:130556387-130556409 GTCATTGCACTGATAAGGTCAGG - Intergenic
1198555812 X:137792285-137792307 GTGCTTGCAGTGAGAATTTCAGG - Intergenic