ID: 975445567

View in Genome Browser
Species Human (GRCh38)
Location 4:74460558-74460580
Sequence GGATACAACAAGTAGCAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975445567_975445572 25 Left 975445567 4:74460558-74460580 CCCTATTGCTACTTGTTGTATCC No data
Right 975445572 4:74460606-74460628 TATAAAAGCACTAGATGCAATGG No data
975445567_975445569 -6 Left 975445567 4:74460558-74460580 CCCTATTGCTACTTGTTGTATCC No data
Right 975445569 4:74460575-74460597 GTATCCTCATAGTTACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975445567 Original CRISPR GGATACAACAAGTAGCAATA GGG (reversed) Intergenic
No off target data available for this crispr