ID: 975447211

View in Genome Browser
Species Human (GRCh38)
Location 4:74479942-74479964
Sequence AAATATATATTCCAGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975447206_975447211 -6 Left 975447206 4:74479925-74479947 CCTGGTTTCAGCCCAAGAAATAT No data
Right 975447211 4:74479942-74479964 AAATATATATTCCAGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975447211 Original CRISPR AAATATATATTCCAGTGGGA AGG Intergenic
No off target data available for this crispr