ID: 975451368

View in Genome Browser
Species Human (GRCh38)
Location 4:74530681-74530703
Sequence TCCCAAGTAGCTGGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1094658
Summary {0: 41425, 1: 153414, 2: 219429, 3: 225665, 4: 454725}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975451368_975451376 17 Left 975451368 4:74530681-74530703 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241
975451368_975451374 11 Left 975451368 4:74530681-74530703 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 975451374 4:74530715-74530737 GAGAATCACTTGAATCAAGGAGG 0: 12
1: 1650
2: 30539
3: 99912
4: 159178
975451368_975451373 8 Left 975451368 4:74530681-74530703 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 975451373 4:74530712-74530734 CAGGAGAATCACTTGAATCAAGG 0: 76
1: 5101
2: 67041
3: 140214
4: 174033
975451368_975451375 14 Left 975451368 4:74530681-74530703 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 975451375 4:74530718-74530740 AATCACTTGAATCAAGGAGGCGG 0: 10
1: 1066
2: 19218
3: 62278
4: 98722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975451368 Original CRISPR TCCCAAGTAGCTGGGACTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr