ID: 975451369

View in Genome Browser
Species Human (GRCh38)
Location 4:74530689-74530711
Sequence CCTCAGTCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 834419
Summary {0: 3992, 1: 102915, 2: 212635, 3: 250751, 4: 264126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975451369_975451373 0 Left 975451369 4:74530689-74530711 CCCAGCTACTTGGGAGACTGAGG 0: 3992
1: 102915
2: 212635
3: 250751
4: 264126
Right 975451373 4:74530712-74530734 CAGGAGAATCACTTGAATCAAGG 0: 76
1: 5101
2: 67041
3: 140214
4: 174033
975451369_975451375 6 Left 975451369 4:74530689-74530711 CCCAGCTACTTGGGAGACTGAGG 0: 3992
1: 102915
2: 212635
3: 250751
4: 264126
Right 975451375 4:74530718-74530740 AATCACTTGAATCAAGGAGGCGG 0: 10
1: 1066
2: 19218
3: 62278
4: 98722
975451369_975451374 3 Left 975451369 4:74530689-74530711 CCCAGCTACTTGGGAGACTGAGG 0: 3992
1: 102915
2: 212635
3: 250751
4: 264126
Right 975451374 4:74530715-74530737 GAGAATCACTTGAATCAAGGAGG 0: 12
1: 1650
2: 30539
3: 99912
4: 159178
975451369_975451376 9 Left 975451369 4:74530689-74530711 CCCAGCTACTTGGGAGACTGAGG 0: 3992
1: 102915
2: 212635
3: 250751
4: 264126
Right 975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975451369 Original CRISPR CCTCAGTCTCCCAAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr