ID: 975451371

View in Genome Browser
Species Human (GRCh38)
Location 4:74530690-74530712
Sequence GCCTCAGTCTCCCAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 762006
Summary {0: 3291, 1: 90134, 2: 199622, 3: 238811, 4: 230148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975451371_975451373 -1 Left 975451371 4:74530690-74530712 CCAGCTACTTGGGAGACTGAGGC 0: 3291
1: 90134
2: 199622
3: 238811
4: 230148
Right 975451373 4:74530712-74530734 CAGGAGAATCACTTGAATCAAGG 0: 76
1: 5101
2: 67041
3: 140214
4: 174033
975451371_975451374 2 Left 975451371 4:74530690-74530712 CCAGCTACTTGGGAGACTGAGGC 0: 3291
1: 90134
2: 199622
3: 238811
4: 230148
Right 975451374 4:74530715-74530737 GAGAATCACTTGAATCAAGGAGG 0: 12
1: 1650
2: 30539
3: 99912
4: 159178
975451371_975451376 8 Left 975451371 4:74530690-74530712 CCAGCTACTTGGGAGACTGAGGC 0: 3291
1: 90134
2: 199622
3: 238811
4: 230148
Right 975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241
975451371_975451375 5 Left 975451371 4:74530690-74530712 CCAGCTACTTGGGAGACTGAGGC 0: 3291
1: 90134
2: 199622
3: 238811
4: 230148
Right 975451375 4:74530718-74530740 AATCACTTGAATCAAGGAGGCGG 0: 10
1: 1066
2: 19218
3: 62278
4: 98722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975451371 Original CRISPR GCCTCAGTCTCCCAAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr