ID: 975451376

View in Genome Browser
Species Human (GRCh38)
Location 4:74530721-74530743
Sequence CACTTGAATCAAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178505
Summary {0: 3, 1: 491, 2: 10053, 3: 50717, 4: 117241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975451369_975451376 9 Left 975451369 4:74530689-74530711 CCCAGCTACTTGGGAGACTGAGG 0: 3992
1: 102915
2: 212635
3: 250751
4: 264126
Right 975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241
975451371_975451376 8 Left 975451371 4:74530690-74530712 CCAGCTACTTGGGAGACTGAGGC 0: 3291
1: 90134
2: 199622
3: 238811
4: 230148
Right 975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241
975451368_975451376 17 Left 975451368 4:74530681-74530703 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG 0: 3
1: 491
2: 10053
3: 50717
4: 117241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975451376 Original CRISPR CACTTGAATCAAGGAGGCGG AGG Intergenic
Too many off-targets to display for this crispr