ID: 975457483

View in Genome Browser
Species Human (GRCh38)
Location 4:74609269-74609291
Sequence GTGAGCAAAGGTATGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975457483_975457485 -10 Left 975457483 4:74609269-74609291 CCTGCAGTCATACCTTTGCTCAC No data
Right 975457485 4:74609282-74609304 CTTTGCTCACTCTGAGACCTTGG No data
975457483_975457486 -1 Left 975457483 4:74609269-74609291 CCTGCAGTCATACCTTTGCTCAC No data
Right 975457486 4:74609291-74609313 CTCTGAGACCTTGGCTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975457483 Original CRISPR GTGAGCAAAGGTATGACTGC AGG (reversed) Intergenic
No off target data available for this crispr