ID: 975459063

View in Genome Browser
Species Human (GRCh38)
Location 4:74629324-74629346
Sequence CTGTGTGCATGAAGGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975459063_975459068 12 Left 975459063 4:74629324-74629346 CCTTCATTCCTTCATGCACACAG No data
Right 975459068 4:74629359-74629381 CCAAACATCTTTGACTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975459063 Original CRISPR CTGTGTGCATGAAGGAATGA AGG (reversed) Intergenic
No off target data available for this crispr