ID: 975461932

View in Genome Browser
Species Human (GRCh38)
Location 4:74664046-74664068
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975461929_975461932 11 Left 975461929 4:74664012-74664034 CCTTGAAAAAGAAGATTTTATAG No data
Right 975461932 4:74664046-74664068 TTTGAATTGGAGAGAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr