ID: 975464714

View in Genome Browser
Species Human (GRCh38)
Location 4:74696346-74696368
Sequence CTACATAAACAGATGGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975464709_975464714 8 Left 975464709 4:74696315-74696337 CCTGCAGCTATAGCATGCAAACA No data
Right 975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG No data
975464705_975464714 28 Left 975464705 4:74696295-74696317 CCTCTGGCACACTACCCAACCCT No data
Right 975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG No data
975464708_975464714 9 Left 975464708 4:74696314-74696336 CCCTGCAGCTATAGCATGCAAAC No data
Right 975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG No data
975464706_975464714 14 Left 975464706 4:74696309-74696331 CCCAACCCTGCAGCTATAGCATG No data
Right 975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG No data
975464707_975464714 13 Left 975464707 4:74696310-74696332 CCAACCCTGCAGCTATAGCATGC No data
Right 975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975464714 Original CRISPR CTACATAAACAGATGGGTAT GGG Intergenic
No off target data available for this crispr