ID: 975466418

View in Genome Browser
Species Human (GRCh38)
Location 4:74714252-74714274
Sequence GAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975466418_975466428 23 Left 975466418 4:74714252-74714274 CCATCCTGCTTCTGCTCACCCTC No data
Right 975466428 4:74714298-74714320 CCAGTCCCAGTGAGATGAGCTGG 0: 72
1: 283
2: 411
3: 326
4: 353
975466418_975466429 24 Left 975466418 4:74714252-74714274 CCATCCTGCTTCTGCTCACCCTC No data
Right 975466429 4:74714299-74714321 CAGTCCCAGTGAGATGAGCTGGG 0: 53
1: 268
2: 806
3: 1033
4: 1193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975466418 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr