ID: 975473901

View in Genome Browser
Species Human (GRCh38)
Location 4:74799903-74799925
Sequence TTATGTGGACCATTATTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975473901_975473904 0 Left 975473901 4:74799903-74799925 CCACCTAATAATGGTCCACATAA No data
Right 975473904 4:74799926-74799948 CTAGTTAGTTTTGAGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975473901 Original CRISPR TTATGTGGACCATTATTAGG TGG (reversed) Intergenic
No off target data available for this crispr