ID: 975475722

View in Genome Browser
Species Human (GRCh38)
Location 4:74821209-74821231
Sequence AAGGAGTTAGATGTGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975475711_975475722 21 Left 975475711 4:74821165-74821187 CCTGCTCTCACCTTCTTCCCAGG No data
Right 975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG No data
975475716_975475722 4 Left 975475716 4:74821182-74821204 CCCAGGTGTGGGAAGCTAGTGAA No data
Right 975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG No data
975475715_975475722 11 Left 975475715 4:74821175-74821197 CCTTCTTCCCAGGTGTGGGAAGC No data
Right 975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG No data
975475717_975475722 3 Left 975475717 4:74821183-74821205 CCAGGTGTGGGAAGCTAGTGAAT No data
Right 975475722 4:74821209-74821231 AAGGAGTTAGATGTGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975475722 Original CRISPR AAGGAGTTAGATGTGGGGCA AGG Intergenic
No off target data available for this crispr