ID: 975476756

View in Genome Browser
Species Human (GRCh38)
Location 4:74832486-74832508
Sequence CTCAGTTCCAGCTTTATTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975476756_975476757 11 Left 975476756 4:74832486-74832508 CCGTGAATAAAGCTGGAACTGAG No data
Right 975476757 4:74832520-74832542 TGCCACTACCTTCTATCCAGTGG No data
975476756_975476761 29 Left 975476756 4:74832486-74832508 CCGTGAATAAAGCTGGAACTGAG No data
Right 975476761 4:74832538-74832560 AGTGGTCTCCTCACCACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975476756 Original CRISPR CTCAGTTCCAGCTTTATTCA CGG (reversed) Intergenic
No off target data available for this crispr