ID: 975476757

View in Genome Browser
Species Human (GRCh38)
Location 4:74832520-74832542
Sequence TGCCACTACCTTCTATCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975476756_975476757 11 Left 975476756 4:74832486-74832508 CCGTGAATAAAGCTGGAACTGAG No data
Right 975476757 4:74832520-74832542 TGCCACTACCTTCTATCCAGTGG No data
975476753_975476757 18 Left 975476753 4:74832479-74832501 CCCAATTCCGTGAATAAAGCTGG No data
Right 975476757 4:74832520-74832542 TGCCACTACCTTCTATCCAGTGG No data
975476755_975476757 17 Left 975476755 4:74832480-74832502 CCAATTCCGTGAATAAAGCTGGA No data
Right 975476757 4:74832520-74832542 TGCCACTACCTTCTATCCAGTGG No data
975476752_975476757 22 Left 975476752 4:74832475-74832497 CCTGCCCAATTCCGTGAATAAAG No data
Right 975476757 4:74832520-74832542 TGCCACTACCTTCTATCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975476757 Original CRISPR TGCCACTACCTTCTATCCAG TGG Intergenic
No off target data available for this crispr