ID: 975476761

View in Genome Browser
Species Human (GRCh38)
Location 4:74832538-74832560
Sequence AGTGGTCTCCTCACCACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975476758_975476761 -7 Left 975476758 4:74832522-74832544 CCACTACCTTCTATCCAGTGGTC No data
Right 975476761 4:74832538-74832560 AGTGGTCTCCTCACCACCCATGG No data
975476756_975476761 29 Left 975476756 4:74832486-74832508 CCGTGAATAAAGCTGGAACTGAG No data
Right 975476761 4:74832538-74832560 AGTGGTCTCCTCACCACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975476761 Original CRISPR AGTGGTCTCCTCACCACCCA TGG Intergenic
No off target data available for this crispr