ID: 975477085

View in Genome Browser
Species Human (GRCh38)
Location 4:74835665-74835687
Sequence CAATTGAAACAGATTCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975477082_975477085 24 Left 975477082 4:74835618-74835640 CCAGACATTTTTAATGACTTTGG No data
Right 975477085 4:74835665-74835687 CAATTGAAACAGATTCACAGAGG No data
975477084_975477085 -8 Left 975477084 4:74835650-74835672 CCATTAATGTTGCTGCAATTGAA No data
Right 975477085 4:74835665-74835687 CAATTGAAACAGATTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975477085 Original CRISPR CAATTGAAACAGATTCACAG AGG Intergenic
No off target data available for this crispr