ID: 975480577

View in Genome Browser
Species Human (GRCh38)
Location 4:74875428-74875450
Sequence CTGTCTAAGGTCAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975480577_975480581 5 Left 975480577 4:74875428-74875450 CCCTCCACATTGACCTTAGACAG No data
Right 975480581 4:74875456-74875478 ATTATTTATTCTGACTTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975480577 Original CRISPR CTGTCTAAGGTCAATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr